angiomotin (AMOT) - coding DNA reference sequence

(used for variant description)

(last modified March 5, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_133265.2 in the AMOT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012628.1, covering AMOT transcript NM_133265.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5016
                                             ccaggagctgccttgg       c.-781

 .         .         .         .         .         .                g.5076
 cagtcacgccccttccttccgaggagctttctggctgcctaaactggtagaccccctgaa       c.-721

 .         .         .         .         .         .                g.5136
 ttactcctccatctccgctctctttcgcctcctcttctcttagttctctccgcctccccc       c.-661

 .         .         .         .         .         .                g.5196
 tcaactaccaccacctccagtcagtctcgcctccggctatccgctgctccaccctctggc       c.-601

 .         .         .         .         .         .                g.5256
 ccggtatcctgcctgtccgctgccaccaaggagagcccggacggagcagcgaggagggga       c.-541

 .         .         .         .         .         .                g.5316
 gcagccgggagttggggcttcccccctgcccatccctggccgctggcccgggaccgaagc       c.-481

 .         .         .         .         .        | 02.             g.13457
 cacttgagcgagcagagagtcgtcaccttgtcttctttgccttcaggg | agctgctaagaa    c.-421

 .         .         .         .         .         .                g.13517
 ggacaaataagatagcagagtgaaagagcttttgtctccttagaaggaaggctgagaaac       c.-361

 .     | 03   .         .         .         .         .             g.29993
 taaag | gccagcgcaggacatctcattgccattgtcagccaggaactcgcagcctcacagc    c.-301

 .         .         .         .         .         .                g.30053
 cctacttcttctctgacctctggggggtccttgcccttgctacaatctccaccatccact       c.-241

 .         .         .         .         .         .                g.30113
 agattgtctcctgcccgacaccccttggtcccaaaccagggagaccattcagctcacctg       c.-181

 .         .         .         .         .         .                g.30173
 cctaggccgcagcagcatttccttcctaatcaggctcaccagggggatcattaccgtctc       c.-121

 .         .         .         .         .         .                g.30233
 tcccaacctggcctgagtcagcagcagcagcaacagcagcagcagcaccatcatcaccat       c.-61

 .         .         .         .         .         .                g.30293
 caccaccaacaacagcagcagcagcagccacagcagcagccaggagaagcctattcagct       c.-1

          .         .         .         .         .         .       g.30353
 ATGCCTCGGGCTCAGCCATCCTCTGCTTCTTATCAGCCAGTGCCAGCAGACCCTTTTGCC       c.60
 M  P  R  A  Q  P  S  S  A  S  Y  Q  P  V  P  A  D  P  F  A         p.20

          .         .         .         .         .         .       g.30413
 ATTGTTTCCAGAGCCCAGCAGATGGTTGAGATCCTCTCAGACGAGAACCGGAACTTGAGG       c.120
 I  V  S  R  A  Q  Q  M  V  E  I  L  S  D  E  N  R  N  L  R         p.40

          .         .         .         .      | 04  .         .    g.34437
 CAAGAGTTGGAAGGATGCTATGAGAAGGTGGCAAGACTGCAGAAG | GTGGAGACAGAAATC    c.180
 Q  E  L  E  G  C  Y  E  K  V  A  R  L  Q  K   | V  E  T  E  I      p.60

          .         .         .         .         .         .       g.34497
 CAGCGCGTCTCGGAGGCATATGAGAACCTCGTGAAGTCATCCTCCAAAAGAGAGGCCCTA       c.240
 Q  R  V  S  E  A  Y  E  N  L  V  K  S  S  S  K  R  E  A  L         p.80

          .         .         .         .         .         .       g.34557
 GAGAAAGCCATGAGAAACAAGCTAGAGGGCGAGATTCGGAGGATGCATGATTTCAACAGG       c.300
 E  K  A  M  R  N  K  L  E  G  E  I  R  R  M  H  D  F  N  R         p.100

          . | 05       .         .         .         .         .    g.35879
 GATCTGAGAG | AGCGTCTAGAGACTGCCAACAAGCAGCTTGCAGAGAAGGAATATGAGGGG    c.360
 D  L  R  E |   R  L  E  T  A  N  K  Q  L  A  E  K  E  Y  E  G      p.120

          .         .         .         .    | 06    .         .    g.40740
 TCAGAGGACACCAGAAAAACCATCTCGCAGCTCTTTGCAAAAA | ATAAAGAAAGCCAGCGT    c.420
 S  E  D  T  R  K  T  I  S  Q  L  F  A  K  N |   K  E  S  Q  R      p.140

          .         .         .         .         .         .       g.40800
 GAGAAGGAGAAGCTGGAAGCGGAGCTGGCCACTGCCCGTTCTACCAATGAGGACCAAAGA       c.480
 E  K  E  K  L  E  A  E  L  A  T  A  R  S  T  N  E  D  Q  R         p.160

          .         .         .         .         .         .       g.40860
 CGACACATCGAAATCCGAGATCAGGCCCTGAGTAATGCCCAGGCCAAGGTGGTAAAGCTG       c.540
 R  H  I  E  I  R  D  Q  A  L  S  N  A  Q  A  K  V  V  K  L         p.180

           | 07        .         .         .         .         .    g.53885
 GAAGAAGAG | CTGAAAAAGAAGCAAGTGTACGTTGACAAGGTGGAGAAGATGCAGCAGGCC    c.600
 E  E  E   | L  K  K  K  Q  V  Y  V  D  K  V  E  K  M  Q  Q  A      p.200

          .         .         .         .         .         .       g.53945
 CTTGTACAGCTCCAGGCAGCATGTGAAAAACGTGAGCAGCTAGAGCACCGTCTCCGGACA       c.660
 L  V  Q  L  Q  A  A  C  E  K  R  E  Q  L  E  H  R  L  R  T         p.220

          .         .         .          | 08        .         .    g.55054
 CGACTGGAGAGGGAACTGGAATCCCTGAGAATCCAGCAG | CGTCAGGGCAACTGTCAGCCC    c.720
 R  L  E  R  E  L  E  S  L  R  I  Q  Q   | R  Q  G  N  C  Q  P      p.240

          .         .         .         .         .         .       g.55114
 ACCAACGTTTCAGAATACAATGCTGCTGCACTGATGGAGCTCCTTCGGGAGAAAGAGGAG       c.780
 T  N  V  S  E  Y  N  A  A  A  L  M  E  L  L  R  E  K  E  E         p.260

          .         .         .         .         .         .       g.55174
 AGGATTCTGGCTCTGGAAGCTGATATGACAAAGTGGGAGCAGAAATATTTGGAGGAGAAT       c.840
 R  I  L  A  L  E  A  D  M  T  K  W  E  Q  K  Y  L  E  E  N         p.280

          .         .         .         .         . | 09       .    g.63163
 GTGATGAGACATTTTGCTCTGGATGCTGCTGCAACTGTGGCTGCTCAGAG | GGACACAACA    c.900
 V  M  R  H  F  A  L  D  A  A  A  T  V  A  A  Q  R  |  D  T  T      p.300

          .         .         .         .         .         .       g.63223
 GTCATCAGTCACTCTCCTAACACCAGCTATGACACAGCTCTAGAAGCTCGCATCCAGAAA       c.960
 V  I  S  H  S  P  N  T  S  Y  D  T  A  L  E  A  R  I  Q  K         p.320

          .         .         .         .         .    | 10    .    g.64704
 GAGGAGGAAGAAATCTTGATGGCCAATAAGCGTTGCCTTGACATGGAGGGCAG | GATTAAG    c.1020
 E  E  E  E  I  L  M  A  N  K  R  C  L  D  M  E  G  R  |  I  K      p.340

          .         .         .         .         .         .       g.64764
 ACCCTCCATGCCCAGATTATTGAGAAGGATGCCATGATCAAAGTACTCCAGCAGCGTTCC       c.1080
 T  L  H  A  Q  I  I  E  K  D  A  M  I  K  V  L  Q  Q  R  S         p.360

          .         .         .         .         .         .       g.64824
 CGGAAGGAGCCGAGCAAGACAGAGCAGCTGTCGTGCATGCGGCCAGCGAAGTCTCTGATG       c.1140
 R  K  E  P  S  K  T  E  Q  L  S  C  M  R  P  A  K  S  L  M         p.380

          .         .         .         .         .         .       g.64884
 TCCATTTCCAATGCTGGATCAGGCTTGCTCTCCCACTCATCCACCCTGACTGGCTCCCCC       c.1200
 S  I  S  N  A  G  S  G  L  L  S  H  S  S  T  L  T  G  S  P         p.400

          .         .         .         .       | 11 .         .    g.66149
 ATCATGGAAGAAAAGCGAGACGACAAGAGCTGGAAGGGGAGCCTAG | GCATTCTCCTGGGT    c.1260
 I  M  E  E  K  R  D  D  K  S  W  K  G  S  L  G |   I  L  L  G      p.420

          .         .         .         .         .         .       g.66209
 GGAGACTACCGTGCTGAATATGTCCCTTCCACACCCTCGCCTGTGCCACCCTCGACTCCC       c.1320
 G  D  Y  R  A  E  Y  V  P  S  T  P  S  P  V  P  P  S  T  P         p.440

          .         .         .         .         .         .       g.66269
 CTGCTCTCGGCTCACTCCAAGACAGGCAGCCGAGACTGCAGTACCCAAACTGAACGTGGG       c.1380
 L  L  S  A  H  S  K  T  G  S  R  D  C  S  T  Q  T  E  R  G         p.460

          .         .         .         .         .         .       g.66329
 ACGGAATCGAACAAAACTGCAGCTGTTGCTCCCATCTCTGTTCCTGCTCCAGTTGCTGCT       c.1440
 T  E  S  N  K  T  A  A  V  A  P  I  S  V  P  A  P  V  A  A         p.480

          .         .         .         .         .         .       g.66389
 GCCGCCACTGCTGCCGCCATCACTGCCACTGCTGCCACCATCACCACCACCATGGTAGCT       c.1500
 A  A  T  A  A  A  I  T  A  T  A  A  T  I  T  T  T  M  V  A         p.500

          .         .         .         .         .         .       g.66449
 GCTGCTCCAGTTGCTGTTGCTGCTGCTGCTGCTCCAGCTGCTGCTGCTGCCCCGTCTCCA       c.1560
 A  A  P  V  A  V  A  A  A  A  A  P  A  A  A  A  A  P  S  P         p.520

          .         .         .         .         .         .       g.66509
 GCCACTGCCGCTGCTACTGCTGCTGCTGTTTCTCCAGCTGCTGCTGGTCAGATTCCAGCT       c.1620
 A  T  A  A  A  T  A  A  A  V  S  P  A  A  A  G  Q  I  P  A         p.540

          .         .         .         .         .         .       g.66569
 GCTGCCTCTGTTGCCTCAGCTGCTGCCGTTGCTCCTTCTGCTGCTGCTGCTGCTGCTGTT       c.1680
 A  A  S  V  A  S  A  A  A  V  A  P  S  A  A  A  A  A  A  V         p.560

          .         .         .         .         .         .       g.66629
 CAGGTTGCTCCAGCTGCTCCGGCTCCAGTTCCAGCTCCGGCTCTGGTTCCGGTTCCAGCT       c.1740
 Q  V  A  P  A  A  P  A  P  V  P  A  P  A  L  V  P  V  P  A         p.580

          .         .         .         .         .         .       g.66689
 CCAGCAGCGGCTCAGGCTTCTGCTCCTGCTCAGACTCAGGCACCAACTTCAGCTCCGGCT       c.1800
 P  A  A  A  Q  A  S  A  P  A  Q  T  Q  A  P  T  S  A  P  A         p.600

          .         .         .         .         .         .       g.66749
 GTGGCTCCAACTCCAGCTCCAACTCCAACTCCAGCTGTGGCTCAGGCTGAGGTTCCTGCA       c.1860
 V  A  P  T  P  A  P  T  P  T  P  A  V  A  Q  A  E  V  P  A         p.620

          .         .         .         .         .         .       g.66809
 AGTCCAGCTACCGGTCCTGGACCACATCGTTTGTCTATACCAAGTTTGACCTGCAATCCA       c.1920
 S  P  A  T  G  P  G  P  H  R  L  S  I  P  S  L  T  C  N  P         p.640

          . | 12       .         .         .         .         .    g.67201
 GACAAAACAG | ATGGGCCTGTGTTCCACTCCAATACTCTGGAAAGAAAAACTCCCATTCAG    c.1980
 D  K  T  D |   G  P  V  F  H  S  N  T  L  E  R  K  T  P  I  Q      p.660

          .         .         .         .                           g.67249
 ATCCTGGGACAAGAGCCTGATGCAGAGATGGTGGAATATCTCATCTAA                   c.2028
 I  L  G  Q  E  P  D  A  E  M  V  E  Y  L  I  X                     p.675

          .         .         .         .         .         .       g.67309
 acggccaaatcaagagctgcagattatcagcaaaaatgcttttaatcattttcccccttt       c.*60

          .         .         .         .         .         .       g.67369
 tattggttcttgttttgagggtgaggacaagggttgtggggaggggatgttttttaacag       c.*120

          .         .         .         .         .         .       g.67429
 gactttttattggaacaatgtactacttgagtaataccatgtgaacaccagtctattttg       c.*180

          .         .         .         .         .         .       g.67489
 gtatgcttagggagtacctctaaagacagattaatcagaatgtgctctaaagcttattgt       c.*240

          .         .         .         .         .         .       g.67549
 ttgaatttatacgaatactgggactgttaacaggtggctatacatcgacgttttcaatgt       c.*300

          .         .         .         .         .         .       g.67609
 gcttaaatttgtttaaattttccatattctagatcattttttattgaagagcacagtatg       c.*360

          .         .         .         .         .         .       g.67669
 tgtggaagacagtgtataacacgtagtttggaagtgggaagctagagagaattgagtgtg       c.*420

          .         .         .         .         .         .       g.67729
 tgctgttttgtatagttactatcctgtgcagcagctggagaaagcactcacctcaggctt       c.*480

          .         .         .         .         .         .       g.67789
 acaaaagggaatagtttcaggagctatgtaagctggaaaaaaggtagggagttttggggt       c.*540

          .         .         .         .         .         .       g.67849
 gcagaagggtactggagctaattttttcttccagtttcccagctaccctgccccagggaa       c.*600

          .         .         .         .         .         .       g.67909
 ttgtgtttgtcttcatttcagtggtgctttggaaatggattcttttggttccctcctgga       c.*660

          .         .         .         .         .         .       g.67969
 ggttcatacattcatatatatgctctggagtaatttatgcatttggataattaatatatt       c.*720

          .         .         .         .         .         .       g.68029
 gctttcagatgctgggagagtacattaactgagtgatgcgcaacttcctctctcttaggg       c.*780

          .         .         .         .         .         .       g.68089
 aattagaccatcagaggccttgatggagagttgcatggggtgctatatgcagacttccat       c.*840

          .         .         .         .         .         .       g.68149
 ggtttgtgtgtagccatgaacacagcttgcttgcatttagtaagaccaatcagcttagtg       c.*900

          .         .         .         .         .         .       g.68209
 tttatttcttctacagcacagattcactggctgggtctccagtctcaaattgccaatcat       c.*960

          .         .         .         .         .         .       g.68269
 ttgcaaagtgaggaaggatctttgttgacaggttgaatgctttgaatttctggtgactac       c.*1020

          .         .         .         .         .         .       g.68329
 tttgaaataacttgttttgtttgtcaaattctaagcatatgtcttaaaaggcatttttga       c.*1080

          .         .         .         .         .         .       g.68389
 ctatcacctccaagggaatagcttgagaaacccaaagtactatgctgcagtcgggggaga       c.*1140

          .         .         .         .         .         .       g.68449
 ggtggattgcagcagtatcctcaactacctcttctcactgtcagtgacaccatcttggaa       c.*1200

          .         .         .         .         .         .       g.68509
 tacctttgggaagcagcaggaaatgtgcatgtgggtagagatcaaaggaggcaatggctc       c.*1260

          .         .         .         .         .         .       g.68569
 caagccttgccatagggctgcctccaaggacacagaaggatgccagttgccacaggtccc       c.*1320

          .         .         .         .         .         .       g.68629
 tgccctgtgtcacctgtctgcccttcattaaggtgagaaatctgcagatagcatcattaa       c.*1380

          .         .         .         .         .         .       g.68689
 gatcagttttaaggggtatagggagggtgagggaagtggggggtgttaggtaagggttgg       c.*1440

          .         .         .         .         .         .       g.68749
 gggtagaggttttgggatgtcttagttagaaaccagattaatagaagagtaggcctgata       c.*1500

          .         .         .         .         .         .       g.68809
 tattacatcatgagccatagtggtgggaaagaactttagcaatatagccctacctcctca       c.*1560

          .         .         .         .         .         .       g.68869
 ttttagtgatgaggaatctgagaactggagaggttcagtgactttttgaaagtcatacaa       c.*1620

          .         .         .         .         .         .       g.68929
 cacagctaaccattatgccaatcaccatgcttattttgggaaactctttatcttttttaa       c.*1680

          .         .         .         .         .         .       g.68989
 attccattttatgaaaaggcatcttcatggtccagggaatatgtatcttgtaaaatgtac       c.*1740

          .         .         .         .         .         .       g.69049
 ctggttggagtagcttgtccagtcttgacaaactactgaatttctgtcttgcctctcctt       c.*1800

          .         .         .         .         .         .       g.69109
 cagtgccttttaaaaggttttcccttttctgatctgcatttcaacatagagtcacataaa       c.*1860

          .         .         .         .         .         .       g.69169
 tgtccccctgagaaaccaatcccacttctttctaggagattgggtatcttagataatctt       c.*1920

          .         .         .         .         .         .       g.69229
 ttggggttcctctgtgagtataggaatggtatccttcctaattatcttccaaaggaatta       c.*1980

          .         .         .         .         .         .       g.69289
 ttttgtgtgtgtgcctgtgtgtgtgtagagacataaaggagggtgatgtgattttcagct       c.*2040

          .         .         .         .         .         .       g.69349
 agtcctttcacattttcaataatgaggtaatcatgttacatacacattagtcctcagtta       c.*2100

          .         .         .         .         .         .       g.69409
 taaagtgaatctcagatagaaattaaaagtgcagttgtgttaagactctttcatactacc       c.*2160

          .         .         .         .         .         .       g.69469
 ctttagtcataaggagaaaaaaacactcaaatagtagaagcagcaagtagcaaacttcag       c.*2220

          .         .         .         .         .         .       g.69529
 gagagctactttctatccaaataatttaaaaaacacttttcacctactcctttcatggtt       c.*2280

          .         .         .         .         .         .       g.69589
 ataacacattggcagactttttgctggctctgggagccatgattttaatcacattctgca       c.*2340

          .         .         .         .         .         .       g.69649
 aggtgacaaatgtcatacattccacattgtgtggtagccatctctttagactcatgtgtt       c.*2400

          .         .         .         .         .         .       g.69709
 ttggggaaaggaagaagttcttggctgagtactattttgaactttccagaaccctctcac       c.*2460

          .         .         .         .         .         .       g.69769
 accagagacagttcttctctgttcagtttccaatccccgataatttgctaaaataacatt       c.*2520

          .         .         .         .         .         .       g.69829
 gtacatccaagagagggaagaagagtatgtcagtatattatgcagaagatagatacagcc       c.*2580

          .         .         .         .         .         .       g.69889
 ttttcagaagatctccactagtttttgttccaaaaattcaagtttatgggagaaatctca       c.*2640

          .         .         .         .         .         .       g.69949
 attagccaccttttcacagttgtgtggatataacatttgggggatctttctggactccta       c.*2700

          .         .         .         .         .         .       g.70009
 cctatctgtgcattttaccggcacctcaggaaaggagggtgaccaggttgtcttagcttg       c.*2760

          .         .         .         .         .         .       g.70069
 tactgcttggtgatctctgaggaccttctaattcagttgtaccccagtgttccatgtata       c.*2820

          .         .         .         .         .         .       g.70129
 gaaaaacttcattagaacaaactttacttgatatgaaactcctattaacagtcttttttt       c.*2880

          .         .         .         .         .         .       g.70189
 gaaataaaaagtagcttgagctttcttttaaaatcatgtatcttgattgttgatttaatg       c.*2940

          .         .         .         .         .         .       g.70249
 aaggatttccttttaatgctgcttttgagcttcaaggtaataggacagcaggaacctaaa       c.*3000

          .         .         .         .         .         .       g.70309
 atatctgccatcatctgccataggaaagatacccagagacccatcatgttctctttttgt       c.*3060

          .         .         .         .         .         .       g.70369
 tgttacactgttgggtgggtataacaattggaaaatgaacaaactgattgattgtgcaaa       c.*3120

          .         .         .         .         .         .       g.70429
 ctactttttatgacaagcctaaaccctcataatgcggcagcttaaagtgtatacatatgc       c.*3180

          .         .         .         .         .         .       g.70489
 actaactttgatcaattatattctcatatctgttagctacacagtctcctattatctcaa       c.*3240

          .         .         .         .         .         .       g.70549
 ttgcttatgtgcatatggaatatgttacttaaaacgtgtgcattcttactgaaaatgttt       c.*3300

          .         .         .         .         .         .       g.70609
 tcaaaggaaggtatcagctgtgggctaattgccaccaatttcagcctgccacgattcttg       c.*3360

          .         .         .         .         .         .       g.70669
 gaaatatgtcttccaagtgccatccatcatcagtaggacaagtgtcgggagtttgtttat       c.*3420

          .         .         .         .         .         .       g.70729
 ttttttccagtagcaacgatgggttacatggagccatgaaacctccttctggcctccctt       c.*3480

          .         .         .         .         .         .       g.70789
 gtgattaatggcatgtgtttgtaaaatggatagctggggttggcagatggctagagaaga       c.*3540

          .         .         .         .         .         .       g.70849
 atcgcctttggtttaaaatgtatgtggtcccctaatgattgtgaccccattctgtaatca       c.*3600

          .         .         .         .         .         .       g.70909
 actgagctagttccaataaagttaagcaggtttaaatccactttgtgcctatcttttcac       c.*3660

          .         .         .                                     g.70939
 tgacaataaagttagctattttaaaatgca                                     c.*3690

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Angiomotin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center