amyloid P component, serum (APCS) - coding DNA reference sequence

(used for variant description)

(last modified June 2, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_001639.3 in the APCS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering APCS transcript NM_001639.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5036
                         gggcatgaatatcagacgctagggggacagccactg       c.-61

 .         .         .         .         .         .                g.5096
 tgttgtctgctaccctcatcctggtcactgcttctgctataacagccctaggccaggaat       c.-1

          .         .         .         .         .         .       g.5156
 ATGAACAAGCCGCTGCTTTGGATCTCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCAC       c.60
 M  N  K  P  L  L  W  I  S  V  L  T  S  L  L  E  A  F  A  H         p.20

      | 02   .         .         .         .         .         .    g.5331
 ACAG | ACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCATGTAAAC    c.120
 T  D |   L  S  G  K  V  F  V  F  P  R  E  S  V  T  D  H  V  N      p.40

          .         .         .         .         .         .       g.5391
 TTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGT       c.180
 L  I  T  P  L  E  K  P  L  Q  N  F  T  L  C  F  R  A  Y  S         p.60

          .         .         .         .         .         .       g.5451
 GATCTCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTA       c.240
 D  L  S  R  A  Y  S  L  F  S  Y  N  T  Q  G  R  D  N  E  L         p.80

          .         .         .         .         .         .       g.5511
 CTAGTTTATAAAGAAAGAGTTGGAGAGTATAGTCTATACATTGGAAGACACAAAGTTACA       c.300
 L  V  Y  K  E  R  V  G  E  Y  S  L  Y  I  G  R  H  K  V  T         p.100

          .         .         .         .         .         .       g.5571
 TCCAAAGTTATCGAAAAGTTCCCGGCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCA       c.360
 S  K  V  I  E  K  F  P  A  P  V  H  I  C  V  S  W  E  S  S         p.120

          .         .         .         .         .         .       g.5631
 TCAGGTATTGCTGAATTTTGGATCAATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAG       c.420
 S  G  I  A  E  F  W  I  N  G  T  P  L  V  K  K  G  L  R  Q         p.140

          .         .         .         .         .         .       g.5691
 GGTTACTTTGTAGAAGCTCAGCCCAAGATTGTCCTGGGGCAGGAACAGGATTCCTATGGG       c.480
 G  Y  F  V  E  A  Q  P  K  I  V  L  G  Q  E  Q  D  S  Y  G         p.160

          .         .         .         .         .         .       g.5751
 GGCAAGTTTGATAGGAGCCAGTCCTTTGTGGGAGAGATTGGGGATTTGTACATGTGGGAC       c.540
 G  K  F  D  R  S  Q  S  F  V  G  E  I  G  D  L  Y  M  W  D         p.180

          .         .         .         .         .         .       g.5811
 TCTGTGCTGCCCCCAGAAAATATCCTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAAT       c.600
 S  V  L  P  P  E  N  I  L  S  A  Y  Q  G  T  P  L  P  A  N         p.200

          .         .         .         .         .         .       g.5871
 ATCCTGGACTGGCAGGCTCTGAACTATGAAATCAGAGGATATGTCATCATCAAACCCTTG       c.660
 I  L  D  W  Q  A  L  N  Y  E  I  R  G  Y  V  I  I  K  P  L         p.220

          .                                                         g.5883
 GTGTGGGTCTGA                                                       c.672
 V  W  V  X                                                         p.223

          .         .         .         .         .         .       g.5943
 ggtcttgactcaacgagagcacttgaaaatgaaatgactgtctaagagatctggtcaaag       c.*60

          .         .         .         .         .         .       g.6003
 caactggatactagatcttacatctgcagctctttcttctttgaatttcctatctgtatg       c.*120

          .         .         .         .                           g.6046
 tctgcctaattaaaaaaatatatattgtattatgctacctgca                        c.*163

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Amyloid P component, serum protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.