apolipoprotein A-II (APOA2) - coding DNA reference sequence

(used for variant description)

(last modified September 12, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_001643.1 in the APOA2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012043.1, covering APOA2 transcript NM_001643.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .      | 02  .         .             g.5227
   aggcacagacaccaaggacagagacgctggctag | gccgccctccccactgttaccaac    c.-1

          .         .         .         .         .   | 03     .    g.5586
 ATGAAGCTGCTCGCAGCAACTGTGCTACTCCTCACCATCTGCAGCCTTGAAG | GAGCTTTG    c.60
 M  K  L  L  A  A  T  V  L  L  L  T  I  C  S  L  E  G |   A  L      p.20

          .         .         .         .         .         .       g.5646
 GTTCGGAGACAGGCAAAGGAGCCATGTGTGGAGAGCCTGGTTTCTCAGTACTTCCAGACC       c.120
 V  R  R  Q  A  K  E  P  C  V  E  S  L  V  S  Q  Y  F  Q  T         p.40

          .         .         .         .         .         .       g.5706
 GTGACTGACTATGGCAAGGACCTGATGGAGAAGGTCAAGAGCCCAGAGCTTCAGGCCGAG       c.180
 V  T  D  Y  G  K  D  L  M  E  K  V  K  S  P  E  L  Q  A  E         p.60

       | 04  .         .         .         .         .         .    g.6161
 GCCAA | GTCTTACTTTGAAAAGTCAAAGGAGCAGCTGACACCCCTGATCAAGAAGGCTGGA    c.240
 A  K  |  S  Y  F  E  K  S  K  E  Q  L  T  P  L  I  K  K  A  G      p.80

          .         .         .         .         .         .       g.6221
 ACGGAACTGGTTAACTTCTTGAGCTATTTCGTGGAACTTGGAACACAGCCTGCCACCCAG       c.300
 T  E  L  V  N  F  L  S  Y  F  V  E  L  G  T  Q  P  A  T  Q         p.100

                                                                    g.6224
 TGA                                                                c.303
 X                                                                  p.100

          .         .         .         .         .         .       g.6284
 agtgtccagaccattgtcttccaaccccagctggcctctagaacacccactggccagtcc       c.*60

          .         .         .         .         .                 g.6336
 tagagctcctgtccctacccactctttgctacaataaatgctgaatgaatcc               c.*112

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Apolipoprotein A-II protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.