apolipoprotein C-III (APOC3) - coding DNA reference sequence

(used for variant description)

(last modified December 12, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_000040.1 in the APOC3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008949.1, covering APOC3 transcript NM_000040.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .       | 02 .             g.5675
               tgctcagttcatccctagaggcagctgctccag | gaacagaggtgcc    c.-1

          .         .         .         .         .      | 03  .    g.5870
 ATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCC | GAGCT    c.60
 M  Q  P  R  V  L  L  V  V  A  L  L  A  L  L  A  S  A  R |   A      p.20

          .         .         .         .         .         .       g.5930
 TCAGAGGCCGAGGATGCCTCCCTTCTCAGCTTCATGCAGGGTTACATGAAGCACGCCACC       c.120
 S  E  A  E  D  A  S  L  L  S  F  M  Q  G  Y  M  K  H  A  T         p.40

          .         .         .         .         .          | 04    g.7857
 AAGACCGCCAAGGATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAG | G    c.180
 K  T  A  K  D  A  L  S  S  V  Q  E  S  Q  V  A  Q  Q  A  R  |      p.60

          .         .         .         .         .         .       g.7917
 GGCTGGGTGACCGATGGCTTCAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAG       c.240
 G  W  V  T  D  G  F  S  S  L  K  D  Y  W  S  T  V  K  D  K         p.80

          .         .         .         .         .         .       g.7977
 TTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGA       c.300
 F  S  E  F  W  D  L  D  P  E  V  R  P  T  S  A  V  A  A  X         p.99

          .         .         .         .         .         .       g.8037
 gacctcaataccccaagtccacctgcctatccatcctgcgagctccttgggtcctgcaat       c.*60

          .         .         .         .         .         .       g.8097
 ctccagggctgcccctgtaggttgcttaaaagggacagtattctcagtgctctcctaccc       c.*120

          .         .         .         .         .         .       g.8157
 cacctcatgcctggcccccctccaggcatgctggcctcccaataaagctggacaagaagc       c.*180

                                                                    g.8164
 tgctatg                                                            c.*187

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Apolipoprotein C-III protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.