ADP-ribosylation factor-like 13B (ARL13B) - downstream reference sequence


         .         .         .            .         .         . g.80561
taactgacttcaaatataaaactatgcatagaaacaaca / ctagaaagaaatgtagtttgg c.*2280

         .         .         .         .         .         .    g.80621
cttacttttgtagtgagggaggcaaatttataatattgtataaattatttaagtaccatg    c.*2340

         .         .         .         .         .         .    g.80681
ttttctgcaagtttaaaattaagtgcttttataaatgccagattaagactacaattccct    c.*2400

         .         .         .         .         .         .    g.80741
taatatgtaaaacctgtgaacatcgtggagcagttcacctgcagaatacaactaaagaaa    c.*2460

         .         .         .         .         .         .    g.80801
tcaaatgcttctaggtagcaaaagctattcacaagctaaattgtttatacatataaagct    c.*2520

         .         .         .         .         .         .    g.80861
gtagcttataaactttatcatccttggctttacttagtaaatttttttgctaagtggaat    c.*2580

         .         .         .         .         .         .    g.80921
atgctttgcaactgagattctgctaataatggtttattaatttatcaggaagtatattcc    c.*2640

         .         .         .         .         .         .    g.80981
aactgatccaaagaacaaattcaaatattttaaaattttcaattaagcatggcataggtt    c.*2700

         .         .         .         .         .         .    g.81041
atcaaaatagcaataatcctttatctttacagaaacagaataatagatacctgttttttg    c.*2760

         .         .         .         .         .         .    g.81101
aggggggaaaaaaagaaagccagaaattaacttcctttaatgaaagagatcagcttataa    c.*2820

         .         .         .         .         .         .    g.81161
ttaaatggaaaataggaaaaaagttcatttgcttgttgagggcttaacttgtaagttcct    c.*2880

         .         .         .         .         .         .    g.81221
tctgtgtgcggatgaggaaatcatttacaacctaggtaagtggatcagtggtttccaagt    c.*2940

         .         .         .         .         .         .    g.81281
ttttattataatatcttctatcagaaaacatttttaatatacattgatgtttatgttatt    c.*3000

         .         .         .         .         .         .    g.81341
gtattagtttgctagggtggccataacaaagtatcacagacaagttgcttaaacaacaga    c.*3060

         .         .         .         .         .         .    g.81401
aatttattttctcagttctggggactggtagtctgagagcaagttggtgggtttgctttc    c.*3120

         .         .         .         .         .         .    g.81461
tcctgaggcccctccttgcctgatagatagacactgtcttgtgtccccacgtggcctttt    c.*3180

         .         .         .         .         .         .    g.81521
ttctccacccacccccactgtctctgtgtgttcgattttcctctttttatgacttcttat    c.*3240

         .         .         .         .         .         .    g.81581
aacttaactttgtaaaggcccatctccaaatatagtcacattctgaggtactgggggtta    c.*3300

         .         .         .         .         .         .    g.81641
aggcatcaacgtgaattttggggggacaaatttcagcccataacagttaacatacttgtt    c.*3360

         .         .         .         .         .         .    g.81701
ctactgcactatgtacattttaaatacacttccctaaaaaaagaaattttaaaagactac    c.*3420

         .         .         .         .         .         .    g.81761
ataaagcttaataaaaataaaagtcattatatttacttcctagacacagtggattgtctg    c.*3480

         .         .         .         .         .         .    g.81821
ctggagtttgtacagaccacattggagccctgaaatttagtaaaatgagaatctcacctg    c.*3540

         .         .         .         .         .         .    g.81881
acgtttaagcctaagattgcctataactatgctgtgttctgtagcattgatcacaggttt    c.*3600

         .         .         .         .         .         .    g.81941
cctgttgtgttttcctgttgtttttctgccatatattttaaggagctcagggctctcttg    c.*3660

         .         .         .         .         .         .    g.82001
atgtcatattgttttactacaaagcgtctccttacctttttgacaacataaacctctata    c.*3720

         .         .         .         .         .         .    g.82061
tgaacatgaagggttttgacacattttatataaatatgaaaattcataaaacatagttta    c.*3780

         .         .         .         .         .         .    g.82121
ggagttattccataaattactctgaaatacttcttaagaccaactgaccttataataaaa    c.*3840

         .         .         .         .         .         .    g.82181
ttgcttagatatgtaaaaatttgtttcctgcctagaggtacgtccttattaagctgcttg    c.*3900

         .         .         .         .         .         .    g.82241
gttctttaacgctaacattaaaaaaagcacaaaaaacaaactaatgtgatttatgttatt    c.*3960

         .         .         .         .         .         .    g.82301
tgtgtcagctcaatgtcttatgtctgcagtggtttaattcaagtttgctgctaacagttt    c.*4020

         .         .         .         .         .         .    g.82361
ttattcctaaaactcaatgtagaattgtttgttctttggtagctatttggggtgcggatg    c.*4080

         .         .         .         .         .         .    g.82421
gggagtaaaatccattaacattctcatgatacacatatattgattctagatagattaaga    c.*4140

         .         .         .         .         .         .    g.82481
ggttaaacataaaagatcaaactatgaaaaggtaaggggagaaacagaagtggcttcact    c.*4200

         .         .         .         .         .              g.82540
cggggaaaaaatgtataagcctgaaagcagtggaatcaataaactcaatttacaatgca     c.*4259


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center