ADP-ribosylation factor-like 13B (ARL13B) - 7714 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.20866
gtaagctgaaaacatttatgtgctttctgaactctattaaattattctgaattatttatt  c.130+60

         .         .         .         .         .         .  g.20926
ttgttaagttgctttattccttattaatttggtacagatactgtgcactgcattacttta  c.130+120

         .         .         .         .         .         .  g.20986
tattcttagtatatttgtgactcttgtggcgaataggctctgtcttaatgggaccagact  c.130+180

         .         .         .         .         .         .  g.21046
attatgtttcagatttgaatacatgcagagatgcagaggctccttgatgcctttgatctg  c.130+240

         .         .         .         .         .         .  g.21106
ctaagagggaatagtatctgtattctagacaataggaaggaaaatttaaaaagatgagct  c.130+300

         .         .         .         .         .         .  g.21166
gcccctgcttttaagaatacccatcttctacttacattttcctggccagaagttagtcac  c.130+360

         .         .         .         .         .         .  g.21226
atgcctatgcttagatgaaagagaggtatagttagccagcatagttctctttgaatctct  c.130+420

         .         .         .         .         .         .  g.21286
tgatgctttttttcaatataagtaatttttataattaaatctatatcattaaacggcttt  c.130+480

         .         .         .         .         .         .  g.21346
atatcatacgtactgcatctcattgaatattgaatatatatcatacatattacatctcat  c.130+540

         .         .         .         .         .         .  g.21406
tgagtgtatctcattgaatgctggctagtcttctttttttttttttaatttttaatttat  c.130+600

         .         .         .         .         .         .  g.21466
taggtctttttttggtagagatggggtctccctatgttgcccaagctggtctggaatgcc  c.130+660

         .         .         .         .         .         .  g.21526
tagcctcaagctattcttctgccttggcctccaagagtgctgggattacaggcatgagcc  c.130+720

         .         .         .         .         .         .  g.21586
accacgcccagcccggccaggtaatcttaatttaatgctttgtgctacaatatagcagta  c.130+780

         .         .         .         .         .         .  g.21646
tctatgctagtgactttgttgggcacctagaatgtatcaccagtcaggcatctaaagtga  c.130+840

         .         .         .         .         .         .  g.21706
gtccccaaccccggggccgtggaccaatatctgtctgtgggctggttcttaggaaccagc  c.130+900

         .         .         .         .         .         .  g.21766
ccacaaagcaggaggtaagcagcaggccagtgaacgaagcttcatctgtatttacatcct  c.130+960

         .         .         .         .         .         .  g.21826
ctccccattactcacattactgcctgaacattgccccctgtcagatcagtggtggcatta  c.130+1020

         .         .         .         .         .         .  g.21886
gattcttaggaccatgaaccctatgtgaactgcacatgcaagagatctaggttatgtgct  c.130+1080

         .         .         .         .         .         .  g.21946
ccttatgagaatctaatgcctaatgatctgtcactgcctcccatcacccccccagatggg  c.130+1140

         .         .         .         .         .         .  g.22006
accatctagttgcaggaaaacaagcttggggtcccactgattgtacattatggtgagttg  c.130+1200

         .         .         .         .         .         .  g.22066
tataattatttcattatgtattacaatgtaataataatagaaataaagtgcacaataaat  c.130+1260

         .         .         .         .         .         .  g.22126
gtaatgtgcttgaatcatcctgaaaccacctctatcctccagtccatggaaaaattgtct  c.130+1320

         .         .         .         .         .         .  g.22186
tctgcaaaactggtccctggtgctgctgatctaaagggtaagaattgggagaaatgcata  c.130+1380

         .         .         .         .         .         .  g.22246
acatgtatttgtttctggaaactgatgattgcagtaagatatcatgcttactaaatagtg  c.130+1440

         .         .         .         .         .         .  g.22306
gaagggcatttattaattaacaggttgcaaaactcactgttggaaaaaaacattttctca  c.130+1500

         .         .         .         .         .         .  g.22366
cctcaaatgctactctgtaatgttaagtaaattatctgttattgtctatgattttttcta  c.130+1560

         .         .         .         .         .         .  g.22426
aagcctatgtctatgctatcttctacgttatatcttcacaggacactcactatcattatt  c.130+1620

         .         .         .         .         .         .  g.22486
taaactagtggtcagcaaactttttctgtaaagagctgagtagtaaatattttagacctt  c.130+1680

         .         .         .         .         .         .  g.22546
gcagtcatccagtctccttctgaactacaaaatttttatactgtagtgtgaaagcagcca  c.130+1740

         .         .         .         .         .         .  g.22606
tagaccatctgcatacatgctgggcacggtggctcacacctgtaataatcccagcacttt  c.130+1800

         .         .         .         .         .         .  g.22666
gggaggccgaggtgggcagatcacctgaggacaggagttcgagaccaggctggccaacat  c.130+1860

         .         .         .         .         .         .  g.22726
ggcgaaaccccatctctactaaaaataccaaaattagctaggtgtggtggcacacacctg  c.130+1920

         .         .         .         .         .         .  g.22786
taatcctagctactcaggaggctgaggcaggaaaattgcttgaaccccggagatggaggt  c.130+1980

         .         .         .         .         .         .  g.22846
tgagtgagctgggattgcgccactgcactccagtctgggcaacagtgagactccgtctca  c.130+2040

         .         .         .         .         .         .  g.22906
aaaaaaaagaagacaatccgtatacaaatgagcatggccaagctccactgaaaatttatt  c.130+2100

         .         .         .         .         .         .  g.22966
tccggcactgaaatttgaatttaatataattttcatgtgttaggaaatatttttctttta  c.130+2160

         .         .         .         .         .         .  g.23026
attttttttagtcatttaaaatgtaaaacacattcttagcttgtgggccatacaaaaaca  c.130+2220

         .         .         .         .         .         .  g.23086
agtggcaaaccagatttgacctggaggccatgacaccttcttctaaccttcttttatcca  c.130+2280

         .         .         .         .         .         .  g.23146
ttcctctaaagcctgacattcatgggagcaggcaccttagaatgtgctaatcagattacc  c.130+2340

         .         .         .         .         .         .  g.23206
taatttgttatgtatactgggtgtacttagaacatcctctttcctttctttctcttatgt  c.130+2400

         .         .         .         .         .         .  g.23266
attccacctccatatattcataagttcctttttctgagtctagaaaatgcttaatgtcaa  c.130+2460

         .         .         .         .         .         .  g.23326
agctgccttcaacttcgagccccactccccattctctttttgtccttcatcccatattta  c.130+2520

         .         .         .         .         .         .  g.23386
ctcttcagtttcttactttgaaatttttttaggactataatttcttagaactacttgaaa  c.130+2580

         .         .         .         .         .         .  g.23446
cttcccagatgtaagccttctctttcctttatatttttgtgttgttctcacttacctaac  c.130+2640

         .         .         .         .         .         .  g.23506
tagagagaatatctactgatgtttaaagatgtatttttgtcgtatagtctcctcttttat  c.130+2700

         .         .         .         .         .         .  g.23566
aaagtcctttttaattcccagctgccccaattactaccttacttagtagaattgatcatg  c.130+2760

         .         .         .         .         .         .  g.23626
tccacttttttggcctgctcttcctgatacctacttggtcactacttaattacattttgt  c.130+2820

         .         .         .         .         .         .  g.23686
ttgtgtatcttttttcttcaggctgtaaattctctaaaggcattttgcttattttggtgt  c.130+2880

         .         .         .         .         .         .  g.23746
cacaattgtttaggccatgcgcctaggtcttcttaaaacacctctctcatggctcctact  c.130+2940

         .         .         .         .         .         .  g.23806
tttctacttatttctgattcttttctgacttctcagccttcttttttttttttttatttc  c.130+3000

         .         .         .         .         .         .  g.23866
cgtgtgaaattgagaaaaagttatctgctagtttcttttcagatgtgtctacctctcctc  c.130+3060

         .         .         .         .         .         .  g.23926
tgactgtgttgccattggctaaatccaaaccctcagtttcttttatctatgatgtcacag  c.130+3120

         .         .         .         .         .         .  g.23986
tagcttttttctaattcatattctatttatttatttatttatttatttataattttttat  c.130+3180

         .         .         .         .         .         .  g.24046
agaggtgagtctcactatgttgcccaggatggtcttgaactcctggcctcaagtgatcct  c.130+3240

         .         .         .         .         .         .  g.24106
cctgccttggcctcccgaagtgttgggatagtaggcatgagccactgagcctggtcatat  c.130+3300

         .         .         .         .         .         .  g.24166
ttttttggttttttagagacagggtatcactttgtcatctaggctggagttcggtggcgt  c.130+3360

         .         .         .         .         .         .  g.24226
gatcatagctcactgtaatctcaaactcctgggctcaagctatcctcctgcctcagcctc  c.130+3420

         .         .         .         .         .         .  g.24286
gagagtagctagactagaggtgtgctccacaatgcctagctaatttttttattcacaata  c.130+3480

         .         .         .         .         .         .  g.24346
gctttttttcccttttttatttttaattttgtgagtacatagtaggtgtatatattacga  c.130+3540

         .         .         .         .         .         .  g.24406
ggtacatgagatttttgtataggcatgcaaggcataataatttcgtcatgaaaaattggg  c.130+3600

         .         .         .         .         .         .  g.24466
tatctattccctgaacatctattctttgcgttactctttcagttgtttttaaatgttcga  c.130+3660

         .         .         .         .         .         .  g.24526
ttaaattattattgactatagtctgcctgttgtgctttcaaatactaggttttattcatt  c.130+3720

         .         .         .         .         .         .  g.24586
ctttctaaatttttttcacaatagcttcttaatataaaagtaacaccccttcctggaact  c.130+3780

         .         .         .         .         .         .  g.24646
ttacttctttaaatcaaacttctcttcttcatggttgtcagtaattgcattagttggaca  c.130+3840

         .         g.24663
caggttcaattgttctc  c.130+3857

--------------------- middle of intron ---------------------
                               g.24664            .           g.24680
                               c.131-3857  acagagacctaagataa  c.131-3841

.         .         .         .         .         .           g.24740
cagtggttcaacaagatagatgtttctttctttctcataacagcctaagcaaaagtagtc  c.131-3781

.         .         .         .         .         .           g.24800
taggactggtttgtcagctccatcgtgttagtcctcaattctttgttctatttgctttgc  c.131-3721

.         .         .         .         .         .           g.24860
catccccagtgttctccctcacctacatggttgaaggtagttcactacaaaatgtgcatt  c.131-3661

.         .         .         .         .         .           g.24920
tcagctagaaggaagaggtaaagggtaaggggaggccatcctccttttctttaggagctg  c.131-3601

.         .         .         .         .         .           g.24980
aaccaaaagctgctgcatcattttagttcacatcatgactagaagcagtggtgttctgga  c.131-3541

.         .         .         .         .         .           g.25040
cctgcttttcatattggctcatatcaactagtgagagccgattatgcatatctcttccca  c.131-3481

.         .         .         .         .         .           g.25100
actctatgtttaggtacctcacattgttagtttgaaattggccatggtcaaagtatttat  c.131-3421

.         .         .         .         .         .           g.25160
actgtggaaattggcagataccatacatgtatcagggttcttctcctccaaatatttaac  c.131-3361

.         .         .         .         .         .           g.25220
aacacatcactggctagcctcccctcatggccaccccttgctgccgtagtagttggggat  c.131-3301

.         .         .         .         .         .           g.25280
tatggtctgttgtaagcagtcatgagcctaggtaaaaaaaaatctaggattctcttgact  c.131-3241

.         .         .         .         .         .           g.25340
atcagatagtgtttcctaatagggaactattgttatttttggtgcgaaaattctttgcgt  c.131-3181

.         .         .         .         .         .           g.25400
ggactggtccctagcattgttgggtattaacatgtcttcattatattgtagttatttgtg  c.131-3121

.         .         .         .         .         .           g.25460
atttgtgaagaggaaaaaaaaaacaaaaaaattatagttactcatatatatatttatgtt  c.131-3061

.         .         .         .         .         .           g.25520
tcatatgtagttatttgtgtatgtgtgtgtgtgtgtgtgtatatgtatatatatatattt  c.131-3001

.         .         .         .         .         .           g.25580
ccccaatagactaagagctctatgggatcagaagatggattttattaatctttgtatttc  c.131-2941

.         .         .         .         .         .           g.25640
tagaaccatgcatagtacttagcttataagaaatgctcaaaaatttattgattgtatatt  c.131-2881

.         .         .         .         .         .           g.25700
tgcattttatcttggactttctagagatgatgtcttaccacatatactctactgaaattc  c.131-2821

.         .         .         .         .         .           g.25760
tcaattggagaccatgtatctttgtattcctggttcttgtatgatttatcatctataatg  c.131-2761

.         .         .         .         .         .           g.25820
ggccctaaatacatgtacgaggatagatggataaatacatgaaaggaaaaaagaaagggt  c.131-2701

.         .         .         .         .         .           g.25880
ggatgtatgggacaggagcttcagttatctcagtggtttggtggtgtagtattgagccct  c.131-2641

.         .         .         .         .         .           g.25940
atatactttgtgctgaatgctaaggatacaaagacatagtcccatgtgttgggaaggtat  c.131-2581

.         .         .         .         .         .           g.26000
aggctattgtgaagatcagtagaggacagaatattatgatagaggtaaaggtgatagtag  c.131-2521

.         .         .         .         .         .           g.26060
aagtaggaggaatcatcaaaaaaggatttatggggaaagttgtacctgaacatttagtct  c.131-2461

.         .         .         .         .         .           g.26120
taagttgtgaaacacaaatgctgaataggaaccagaggaaagaatagaaggtgttccata  c.131-2401

.         .         .         .         .         .           g.26180
tatcaaaagaaacaggctttggaagtcctgaagacctctgtttgaggcctgtctctgcct  c.131-2341

.         .         .         .         .         .           g.26240
gctatataaccttgaaaaaaaatccttaatctgaattggtttactgggcatattgccatc  c.131-2281

.         .         .         .         .         .           g.26300
attttatctgtacttaaattgctccctctgcctaaaatatagttctcccttctctgttac  c.131-2221

.         .         .         .         .         .           g.26360
aattatgtagcttttatgtgttcactcacaatgaagtcttcatttcaagattttatttct  c.131-2161

.         .         .         .         .         .           g.26420
tctctgaaagcctttctagaccataacttgcccctccctttttcaccttccttcccttga  c.131-2101

.         .         .         .         .         .           g.26480
attcctacacactatcgtctctagcttattttttttaaagaacatacaaattctgtgtta  c.131-2041

.         .         .         .         .         .           g.26540
ttcctattaatattccacttctctatattacattgtactttgaggacagcaatcatatct  c.131-1981

.         .         .         .         .         .           g.26600
tactcatctttgcacccttgatgcctaacaaagtcctggtaccaaggaggtgtttgatac  c.131-1921

.         .         .         .         .         .           g.26660
atgttagttcccttattcctacttcagcatagttgatttgttttcactgatgattgcctg  c.131-1861

.         .         .         .         .         .           g.26720
gggttcctctctattcatactgaaagacagctgcctattttatccacacaaactacttct  c.131-1801

.         .         .         .         .         .           g.26780
ggttaagcttagatcacatttttaaatgcctagtataatcctatttctggaaaatcattc  c.131-1741

.         .         .         .         .         .           g.26840
tgcttatatgtctaactttacctttttctttttctaggtaatgaaagtattagcaaaagt  c.131-1681

.         .         .         .         .         .           g.26900
atgacttgtagtggctcttaactttctcaggtgctgtgtaaacttcactaaggtgcttac  c.131-1621

.         .         .         .         .         .           g.26960
caagagattggtgtgttgcaagtctgtttctcagtcacacctaagtttagtgaatgcctt  c.131-1561

.         .         .         .         .         .           g.27020
tcaaattaatctttgtaatagcaaatgttttgctaaatgtggaaataagaccctctaaac  c.131-1501

.         .         .         .         .         .           g.27080
accggtgttgttcagtagaactttctgcaatgatggaaatgttctatattggctctgtcc  c.131-1441

.         .         .         .         .         .           g.27140
agtagggtggaccactagccacatgtgacttttttttttaaactctagatgttacccaga  c.131-1381

.         .         .         .         .         .           g.27200
ctagtctcaaattcctggcctcaggtgatccttccgcctcagcctaccaaagtgctgaga  c.131-1321

.         .         .         .         .         .           g.27260
tttcaggcctgagccactgtacccagccaccacatatggcttttgaacacttgaaatgta  c.131-1261

.         .         .         .         .         .           g.27320
actgatgcaactgagaactgaattttaaattttattttagtttatttaaatttaaaaagc  c.131-1201

.         .         .         .         .         .           g.27380
ctcgtgtggcttgtggcttttgttttgaccatgcagctctgaacaatgttttctgtggga  c.131-1141

.         .         .         .         .         .           g.27440
taatatttatagtggattccagtgatgaagaaaaaatagaacagaaaaatataaagtttg  c.131-1081

.         .         .         .         .         .           g.27500
aacttttctctgtagccatgagtcagtatgccattaatctttcatgagttctcttttcta  c.131-1021

.         .         .         .         .         .           g.27560
ttcctttattttcatgcctctctgaaaagaggctattactgtcacttccagtcagtctag  c.131-961

.         .         .         .         .         .           g.27620
agacttttgcaagattaattttaataaagcactatttcagtcaccttaattatatcattg  c.131-901

.         .         .         .         .         .           g.27680
gtctgccagatattttcaataattccttgttctctatcttcagaaccctcttctatttgc  c.131-841

.         .         .         .         .         .           g.27740
attcctaatcttaaggatttgctgtaggcacaatgttcaatttgttcatattcctttact  c.131-781

.         .         .         .         .         .           g.27800
ttgccatttcccttcctcttctgcctgtttaaatcctatacagctttaaggcctaaattc  c.131-721

.         .         .         .         .         .           g.27860
tatctctccaatgaggtcttttaagatcctcaggtatcttttaaagctcttattgtcatt  c.131-661

.         .         .         .         .         .           g.27920
atcactccttggcagttcatatacctcctgtatcttctttatgttttcgtatatagaaat  c.131-601

.         .         .         .         .         .           g.27980
ccaaaaaaattcaattatgtatttattggaacatccaaaatatgttcctatagaaagaat  c.131-541

.         .         .         .         .         .           g.28040
gaaatctactttttgttgcaagctgcccttaaacgtctctttattgtaaatataacttta  c.131-481

.         .         .         .         .         .           g.28100
attcagctaattaaaaaagagtggccttattctttatagcttctctcattctttgattct  c.131-421

.         .         .         .         .         .           g.28160
tctaaactcttctattctctaagtgttcatggttttctttataactccacagatgtttta  c.131-361

.         .         .         .         .         .           g.28220
atagtccctggggatggctatggtattgaaaggttgacatttttattgtttgtaacttgg  c.131-301

.         .         .         .         .         .           g.28280
acagtaaatagccttaaaggcaagagtttattcatttattaattcaacagatacttacta  c.131-241

.         .         .         .         .         .           g.28340
agtacctattatatactaggtgtgggtgttatatcaggggaaagaaagattcctatctgc  c.131-181

.         .         .         .         .         .           g.28400
atggagtaaaatttctagtttgatattctggcctgtccccaaaccagtatgcttcaaaat  c.131-121

.         .         .         .         .         .           g.28460
aatgtttattgtgtcagtgaatgctaaatatttcacttgggtgctaaaattttagttgaa  c.131-61

.         .         .         .         .         .           g.28520
aaattaacgttgtcaattaaagtctaaagattttctttttttgtgtatcatttgtaacag  c.131-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center