ADP-ribosylation factor-like 13B (ARL13B) - 1115 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.60358
gtaaggttttttttttttttttaattttaattttttgtcctttcaaataggttcagtata  c.486+60

         .         .         .         .         .         .  g.60418
acttggtttttataaaagtgatagcaattaaaaggcaatgttttcaaagaattttttgta  c.486+120

         .         .         .         .         .         .  g.60478
acctatgaaatcacattcccatttttctgttgatataacttaataccataatatttgttg  c.486+180

         .         .         .         .         .         .  g.60538
tctatttcattgttatttccatgaactatctttccatgatttcaaggagcttcacatttg  c.486+240

         .         .         .         .         .         .  g.60598
cgttttaacatagccaacacatcatggcatgaaatttgtaaaatgggaaagaaaagtgta  c.486+300

         .         .         .         .         .         .  g.60658
aatacaaaatttaaacatatgagagattcataatgaattttgaaaaattattttgctggg  c.486+360

         .         .         .         .         .         .  g.60718
catggtagctcatgcctgtaatcccagcactttgggaggttgaagggggcagattgcttg  c.486+420

         .         .         .         .         .         .  g.60778
agcccaggagtttgagaccaacctgggcaacatagtgagaccctagctctacaaaaaata  c.486+480

         .         .         .         .         .         .  g.60838
caaaaactagctgggtgtggtagtgtgttcctgtagtcccagctgcttgagggggctgag  c.486+540

         .          g.60856
gtgggaagaccactggac  c.486+558

--------------------- middle of intron ---------------------
                                g.60857           .           g.60873
                                c.487-557  cctgggaggctgaggct  c.487-541

.         .         .         .         .         .           g.60933
gcagtgagttctaattcagccactgcactccagcctggccaacagaatgagacactgcct  c.487-481

.         .         .         .         .         .           g.60993
ctaaaaaacaaaaaaagaaaagataaatcatatcaggagagatgtcatacagtcttaagg  c.487-421

.         .         .         .         .         .           g.61053
aagatgaacagtggatttaataatttattttggtttcaaaaaacattaggctgtcaatct  c.487-361

.         .         .         .         .         .           g.61113
tatggatgtttactgctgtatattgtagtataaggaattaaaacttcctggcatttttaa  c.487-301

.         .         .         .         .         .           g.61173
tcaatagagatgtctttttatggtagttaaattttttcttctaatattataagtggcact  c.487-241

.         .         .         .         .         .           g.61233
gtcaccctcttctttataatatcttacatagtgtacagatgttatctgtaaaatatttta  c.487-181

.         .         .         .         .         .           g.61293
agttctatatactgatgttaatcattgcagtgctatgttttggaagttaaataagcagat  c.487-121

.         .         .         .         .         .           g.61353
gcttcatattattaacttaaatggcttaattttgatttgccattaattatacttaatggt  c.487-61

.         .         .         .         .         .           g.61413
ttatgaatagatttgtgtggagaccttttaatcttttagtcaaataaatttctgttttag  c.487-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center