ADP-ribosylation factor-like 13B (ARL13B) - 6165 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.68162
gtaataaatctagttatttaaagtaattatcttatgtatatataaataaaacttatactt  c.1024+60

         .         .         .         .         .         .  g.68222
catctcattttttatgtttgtttttacaaacgagtacttcaatatttttctgtcttcaaa  c.1024+120

         .         .         .         .         .         .  g.68282
tgccatatttaccatgattttctcaaggtcttttattattcagtttgttcctaacctgtt  c.1024+180

         .         .         .         .         .         .  g.68342
tttccatgacttaaaatgtggtcctttgtaacttataaggatttcagcagaaaattccat  c.1024+240

         .         .         .         .         .         .  g.68402
ttttattttcataaatttgggatacagcatagctctcaagaatccttggaatagccctcc  c.1024+300

         .         .         .         .         .         .  g.68462
ccctcctccccctcccccctccctcttcccctctccctcttcccctctctccctccccct  c.1024+360

         .         .         .         .         .         .  g.68522
ccccctctccccctccccctcctcccctccccctccctctccttccctcccccctcccct  c.1024+420

         .         .         .         .         .         .  g.68582
ttctttctttctttctttctacagtctccctctcttgccgagcctggactgtactgccat  c.1024+480

         .         .         .         .         .         .  g.68642
gatctcggctcactgcaacctccctgcctcgggctcctgtgattctcctgccttagcctg  c.1024+540

         .         .         .         .         .         .  g.68702
ccgagtgcctgggattccaggcacgcgccgccactcctgactggtttttgtatttttggt  c.1024+600

         .         .         .         .         .         .  g.68762
ggagatggggtttcgccatgttgaccgatctggtctccagctcctggccttgggtgatcc  c.1024+660

         .         .         .         .         .         .  g.68822
gcccacctcggcctcccgaggtgctgggattgcagacggagtctcgctcactcaacgctc  c.1024+720

         .         .         .         .         .         .  g.68882
aatgttgctcaggctggagtgcagtggcgtgatctcggctcgctacaacctccacctccc  c.1024+780

         .         .         .         .         .         .  g.68942
agccgcctgccttggcctcccaaagtgctaagattacagcctctgcctgcccgccacccc  c.1024+840

         .         .         .         .         .         .  g.69002
gtctaggaagtgagcagcgtctctgcctggccgcccatcgtctgggatgtgaggagcccc  c.1024+900

         .         .         .         .         .         .  g.69062
tctgcccggctgccccatctgggaagtgtggagcgcctctgcctggctgccaccctgtct  c.1024+960

         .         .         .         .         .         .  g.69122
aggaagtgaggagtgtctctgcctggccgcccatcatctgggatgtgaggagcgcccctg  c.1024+1020

         .         .         .         .         .         .  g.69182
gccggccgccctgtctgggaagtgaggagcgcctctgcccggccgccccgtctgggaggt  c.1024+1080

         .         .         .         .         .         .  g.69242
gaggagcgcctctgcccggccgccaccccgtctgggatgtgaggagcgtctctgcccagc  c.1024+1140

         .         .         .         .         .         .  g.69302
cgccaccccatctaggaagtggggagtgcctctgcccggctgccctgaatgggaagtgag  c.1024+1200

         .         .         .         .         .         .  g.69362
gagcgcctctgcccggccaccccgtctgggaagtggggagcgcctctgcctggctgcccc  c.1024+1260

         .         .         .         .         .         .  g.69422
gtctgggaagtgaggagcgcttctgcctggccgctccatctgggaggtgaggagcgcctc  c.1024+1320

         .         .         .         .         .         .  g.69482
tgcctggccgccaccgcatctgggaggtgaggagcgtctctgcccggccgccaccctgtc  c.1024+1380

         .         .         .         .         .         .  g.69542
tgggaagtggggagcgcctctgcccggctgccccatcgggtaggtgaggagtgcctctgc  c.1024+1440

         .         .         .         .         .         .  g.69602
ccggctgcccatcgtctgggaagtgaggagcgcctctgcccggccacccatcgtctggga  c.1024+1500

         .         .         .         .         .         .  g.69662
ggtgaggagcgcctctgcccggccgccccgaatgggaagtgaggagcgcctctgcccggc  c.1024+1560

         .         .         .         .         .         .  g.69722
cgcgccgtctgggaagtggggagcgcctctgcccggccgccccgtctgggaagtgaggag  c.1024+1620

         .         .         .         .         .         .  g.69782
cgtctctgcctgcccgcccctcgtcggggaggtgaggagcgcctctgcccgccgccgcat  c.1024+1680

         .         .         .         .         .         .  g.69842
ctgggaggtgtacccaacagctccgaagagacagtgaccatcaagaacgggccatgatga  c.1024+1740

         .         .         .         .         .         .  g.69902
cgatggcggttttgtcgaaaagaaaagggggaaatgtggggaaaagaaagagagatcaga  c.1024+1800

         .         .         .         .         .         .  g.69962
tggttactgtgtctgtgtagaaagaagtagacatagaagactccattttgttctgtacta  c.1024+1860

         .         .         .         .         .         .  g.70022
agaaaaattcttctgccttgggatgctgttaatctataaccttacccccaaccctgtgct  c.1024+1920

         .         .         .         .         .         .  g.70082
ctctgaaacgtgctgtgtcaactcagggttaaatggattaagggcggtgcaagatgtgct  c.1024+1980

         .         .         .         .         .         .  g.70142
ttgttaaacagatgcttgaaggcagcatgctcattaagagtcgtcaccactccctagtct  c.1024+2040

         .         .         .         .         .         .  g.70202
gaagtacccagggacacaaacactgcggaaggctgcagggagctctgcctaggaaaacca  c.1024+2100

         .         .         .         .         .         .  g.70262
gagacctttgttcacgtgtttatctgctgaccttctctccactattatcctatgaccgtg  c.1024+2160

         .         .         .         .         .         .  g.70322
ccacatccccctctccgagaaacacccaagaatgatcaataaatactaaaaaaaaaaaaa  c.1024+2220

         .         .         .         .         .         .  g.70382
aagaaagaaagaaaaaaaagagttaaaatgccagagcccccaactgatctgtagatttaa  c.1024+2280

         .         .         .         .         .         .  g.70442
ggcaattccaaacaaatcccagcatgagtctttgtagatataggcaagttcattataaaa  c.1024+2340

         .         .         .         .         .         .  g.70502
tatatgtaaaagtaaaggactggaatacccaaaacaattttgaagaaagatcaaggttaa  c.1024+2400

         .         .         .         .         .         .  g.70562
agactcatactacccaatttaagacatactataaagtagtggccgggcacagtggctcat  c.1024+2460

         .         .         .         .         .         .  g.70622
acctgtaatcccgacactttgggaggctgaggcgggaggatcacgaggacaggagatcga  c.1024+2520

         .         .         .         .         .         .  g.70682
gaccacagtagagaccccgtctctactaaaaatccaaaaaattagccaggcgtggtggtg  c.1024+2580

         .         .         .         .         .         .  g.70742
ggcgcctgtggtcccagctactcaggaggctgaggcaggaaaatggcgtgaacctgggag  c.1024+2640

         .         .         .         .         .         .  g.70802
gcagagcttgcagtgagccgagatggtgccactgcactccagcctgggcaacagagcaag  c.1024+2700

         .         .         .         .         .         .  g.70862
actccatcacaaaaaaaaaaaaaaaaagaaaaaaaaaagacatactataaaataaaacca  c.1024+2760

         .         .         .         .         .         .  g.70922
cagtgatcataacagtatagtattgactagaggatagacacagagatcaataaaacacaa  c.1024+2820

         .         .         .         .         .         .  g.70982
tagagattctagaaatagatccccaaaatatggtaattttaatgagtttcattgaggtat  c.1024+2880

         .         .         .         .         .         .  g.71042
aattgacttacaacaaactgcacatatttatagtataaagattgatacattttgatatat  c.1024+2940

         .         .         .         .         .         .  g.71102
gtatacatatgtaaaaccatcagcccaatcaaaatagtgaacataaacattatccccaaa  c.1024+3000

         .         .         .         .         .         .  g.71162
agtttcttcatgtcctttagtaatcccttctttcctcccctctctacttctccacctcat  c.1024+3060

         .         .     g.71185
ctcctggcaatcactgatctgct  c.1024+3083

--------------------- middle of intron ---------------------
                         g.71186        .         .           g.71207
                         c.1025-3082  ttatatcatttatattcattta  c.1025-3061

.         .         .         .         .         .           g.71267
tattccttgaatataaaatattcctttatatttatatactattccttgaatataatatat  c.1025-3001

.         .         .         .         .         .           g.71327
tcctttatattaatggaatcatatagaatgtacttttttgtcttgctttctgaactcaac  c.1025-2941

.         .         .         .         .         .           g.71387
gtcattcctttgagaatcatccatgttgtagcatgtatcaatagtccattcttttttatt  c.1025-2881

.         .         .         .         .         .           g.71447
gctctgaggtagtccatcatatccatgtaccgtactttgcttatctagtcacttgttggt  c.1025-2821

.         .         .         .         .         .           g.71507
gggcattcaggtgtatactgttttggctattacaaataaacctgatatgaacattcatgt  c.1025-2761

.         .         .         .         .         .           g.71567
acaacaaaaaaaaagaatccttggaataaatttaacatcttaaggttttttgtttgtttt  c.1025-2701

.         .         .         .         .         .           g.71627
ttaaggctcataaatgctacatcagcatcatttcctttattgactggctattgctgtagg  c.1025-2641

.         .         .         .         .         .           g.71687
ttgcaaactttattggtacaacatttttaaaatgtcttgtcaaatagccatttttctctt  c.1025-2581

.         .         .         .         .         .           g.71747
attttaatatcataaaaaatcttcaacttataattgcttttctttttctaactggctatg  c.1025-2521

.         .         .         .         .         .           g.71807
ttatataacagaatgttcatgatttttggtatcgtagggatatagcctgcatttggaatc  c.1025-2461

.         .         .         .         .         .           g.71867
acacaacttgggatagaatcttgactctcttatctactagatatacgttaagttatgtaa  c.1025-2401

.         .         .         .         .         .           g.71927
cattctttagtcttagtttcttcatctctaaaatgcaaataaatattgtctttattcaca  c.1025-2341

.         .         .         .         .         .           g.71987
agatttttagggttacttagaaaataactctactcctagtagtgtcagccacatgagatg  c.1025-2281

.         .         .         .         .         .           g.72047
cgccctataattgttgcttccttgacatttttagttatgaatatggctttgttatttata  c.1025-2221

.         .         .         .         .         .           g.72107
agaaatttttatagtatcacagggcttatgaaaataagatttcaattcctgagatacaga  c.1025-2161

.         .         .         .         .         .           g.72167
ttagctaacatggatattttgctggatgaaaatattaatttgaaagttatactttttgtc  c.1025-2101

.         .         .         .         .         .           g.72227
agttgggaagttagggcagtcatatattacccatgtaactgtcagcagagttaaaaagga  c.1025-2041

.         .         .         .         .         .           g.72287
agtagacctattacagtggtcgctaagtttttgaatagttctctactgcttgttaaagaa  c.1025-1981

.         .         .         .         .         .           g.72347
caaaatgattttggcaaatgatttgaaaatatagcacagggagatctcaggtagtaaatc  c.1025-1921

.         .         .         .         .         .           g.72407
atgtaactataataataactaacattatattttatactttaaaagatgcctttgtatgca  c.1025-1861

.         .         .         .         .         .           g.72467
ctatattattcaacataatattttgttatttaacatagcaatcccagggtatagtattcc  c.1025-1801

.         .         .         .         .         .           g.72527
attatataaatgaagaaaccagggacttgaagaggttgagtaacttaagatcatatatct  c.1025-1741

.         .         .         .         .         .           g.72587
gtctgtgtaagctgagaccccagtccagatcatctgatccacatcctgtgctttaacgtg  c.1025-1681

.         .         .         .         .         .           g.72647
accctgaactaatgcctaccctaaagtaccatttggtggttgtattcttccacatcttgt  c.1025-1621

.         .         .         .         .         .           g.72707
ggatctattcttccagttgttaggcttaccactttaattgtacaaagacctatttgtttt  c.1025-1561

.         .         .         .         .         .           g.72767
tatatgaagtgaaatgtttcaaacaacactaatttatttagaataataatttgtttctaa  c.1025-1501

.         .         .         .         .         .           g.72827
gtgtgattgtattttttattgctttttaggcttcacagatattgtatatattttatgtta  c.1025-1441

.         .         .         .         .         .           g.72887
cagataattcccatttagaaagtacattgcatagacacacacacacacacacacacacac  c.1025-1381

.         .         .         .         .         .           g.72947
acacacacacacggcaattttgaaatattgcagttacattggctgggcagggtggctcac  c.1025-1321

.         .         .         .         .         .           g.73007
atctgtaatcccagcactttgggaagccaaggagtgcagatcacttggtcaggagttcaa  c.1025-1261

.         .         .         .         .         .           g.73067
aaccagtctgtgcaacatggcaaaagcccatctctacaaaaaaatacaaaaattagcagc  c.1025-1201

.         .         .         .         .         .           g.73127
atatagtggcacatgcctgcaatcccagctactctggagcctgagacacaagaatcactt  c.1025-1141

.         .         .         .         .         .           g.73187
gaacctgggaggtggagattgcagtgagccaagatcgcaccactgcactccagcctgggc  c.1025-1081

.         .         .         .         .         .           g.73247
agagagtgaggaaaaaaaattgcagtaacattgatgttctaaatttagttaactactatg  c.1025-1021

.         .         .         .         .         .           g.73307
tcatcctaatttaccttactaaaatttatacattaacatagatttccttaaagtgtttat  c.1025-961

.         .         .         .         .         .           g.73367
atgtgtttaagttaaaatatgtaaataatttttaaaagaaagaacacattcaattctgct  c.1025-901

.         .         .         .         .         .           g.73427
agttctaatgcgattttggttacgtgtttgtattgtattgggcctaccttctttaggagt  c.1025-841

.         .         .         .         .         .           g.73487
tattttatttgtttatttacttatttatttgatttttttttttctgagatagattctcac  c.1025-781

.         .         .         .         .         .           g.73547
tctgtcaccaaagctggatggcagtgtcacaatcacactcactgcagccttgaactccag  c.1025-721

.         .         .         .         .         .           g.73607
ggctcaagtgatccttctgcctcagcctcctgaatagttgggactacaggcacatgaaaa  c.1025-661

.         .         .         .         .         .           g.73667
caaagccatgctggggttttttttttcccccatagagatgaggtctccttatgttgccca  c.1025-601

.         .         .         .         .         .           g.73727
gaccattctcttaactcctgggctcatgcattcctcctacttcagcctcccagagtgctg  c.1025-541

.         .         .         .         .         .           g.73787
agattacaggtgtgagctgccatgcatagccttgtaggggttattttaaataagtaacat  c.1025-481

.         .         .         .         .         .           g.73847
gtttagatttgtttagggccttttatgtcacatttcaaaggattatatttgggctattta  c.1025-421

.         .         .         .         .         .           g.73907
tacctggaatcattctacatatcccactgagaaaaatcaaatatactgagtgacacaata  c.1025-361

.         .         .         .         .         .           g.73967
atgaatagcttcttttcccagattattatgaagttcatggaaactcttgcaattagacaa  c.1025-301

.         .         .         .         .         .           g.74027
ttatatttgtgtcatatgacatttttttgtattctgaaaaacctctcagaaattaaaata  c.1025-241

.         .         .         .         .         .           g.74087
tagaattttggctctttttatcatattcattgctcattcattcattcaataagccatcac  c.1025-181

.         .         .         .         .         .           g.74147
ttaaaaaatatattcttagtaaatgcaagtacacatttggttattgtaacaatttccaaa  c.1025-121

.         .         .         .         .         .           g.74207
gttaaatagtcaagatgttttttgttaataatatcagtattcttgttgtattctttgttt  c.1025-61

.         .         .         .         .         .           g.74267
tctattataaaagtgcactttttcataaagacatgaagtttcatgtttatattcttgtag  c.1025-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center