ADP-ribosylation factor-like 13B (ARL13B) - 1301 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.74444
gtgagtaaattgatactgatactgaatttagaaatattgctttaaacaacagagaaaaaa  c.1141+60

         .         .         .         .         .         .  g.74504
aaaaagaaaaaaggaatcttgtcatttttattctgtatattcattatcttgtatacttgt  c.1141+120

         .         .         .         .         .         .  g.74564
gaagaagaatcttttactctgatttggacaaaatttgctaacacaaatgtccattgcttt  c.1141+180

         .         .         .         .         .         .  g.74624
tttgaataaaaaaatgttttataaagaaaaaaataagtaaaaactattaagaaaatttta  c.1141+240

         .         .         .         .         .         .  g.74684
cccagtatttcctagaatatgttcaagttctatttgaaatatcagtacccacatgttaat  c.1141+300

         .         .         .         .         .         .  g.74744
ttaagtttcacgatggatggctaacatgagtttttaaaacattgaaccggctcggcatgg  c.1141+360

         .         .         .         .         .         .  g.74804
tggctgacacctgtaatcccagcactttgtgaggccgaggcgggcagataaccaggtgaa  c.1141+420

         .         .         .         .         .         .  g.74864
gagttcgagatcaacctggccaacttggtgaaaccccgtctctactaaagatacaaaaaa  c.1141+480

         .         .         .         .         .         .  g.74924
aaaaaaaaaaaattagctgggcgtagtagcacatgcctgtaatcccagctactcaggagg  c.1141+540

         .         .         .         .         .         .  g.74984
ctggggcaggagaatcgcttgaacctgggatggagaagttgcagtgagccaagatcactc  c.1141+600

         .         .         .         .         .   g.75035
cattgcactccagcctgggtgacagggtgagactccatctcgggaaaaaaa  c.1141+651

--------------------- middle of intron ---------------------
        g.75036     .         .         .         .         .           g.75085
        c.1142-650  aaaaaaaaaaaaaattggacctttcatcctgaaagttaatgtttgaaacc  c.1142-601

.         .         .         .         .         .           g.75145
aagatgtattaattttttctaatacattttcaatatacatacccatgtcctaagttgtta  c.1142-541

.         .         .         .         .         .           g.75205
cgaggattaaatggagtaatgcatataaaacactgggacttaacttgcacaataattttg  c.1142-481

.         .         .         .         .         .           g.75265
agtaacttttcagcactaagcttagcacctcacctactataggtggtcagtaaatatgta  c.1142-421

.         .         .         .         .         .           g.75325
atgactagataaatatgtgtatagtgcccttatagccctgctacaaggctttagaaatta  c.1142-361

.         .         .         .         .         .           g.75385
tttggtaacattttaagaatctcttatagactcatttccagtattccatttattaagaaa  c.1142-301

.         .         .         .         .         .           g.75445
atatttagtttctgcctagagttagaatgatagcatgagtttgtttttgatagtggtgaa  c.1142-241

.         .         .         .         .         .           g.75505
ggtgcttatagtttttattaaaagctactgaaaagttaaagcagatgttagcagcctata  c.1142-181

.         .         .         .         .         .           g.75565
attacattttaaaatatagaagccatttaaaatgggtttctggctttccatactgtcatt  c.1142-121

.         .         .         .         .         .           g.75625
caatatatttgaattgacattgaatgttacatatgcttcctttccagggagggatcctct  c.1142-61

.         .         .         .         .         .           g.75685
caacagacctaaagaaaccttgtttaacagtgttttttaaatgtttttctttttctttag  c.1142-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center