ADP-ribosylation factor-like 13B (ARL13B) - 2294 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.75814
gtaatgcaaaaggattggttttcagatatcatctgtacatgtcacattcacttttcttta  c.1210+60

         .         .         .         .         .         .  g.75874
gccttataatttcaacaaacttatgttttagttttagaagcttgtcaaatccacagctat  c.1210+120

         .         .         .         .         .         .  g.75934
cctttttcattatacgtcttttttcattttatttaattttttattcttaagtatgcttta  c.1210+180

         .         .         .         .         .         .  g.75994
catctatatcatttaatttggtgtttaccttagaatacagaggtaaaaagaatcatagct  c.1210+240

         .         .         .         .         .         .  g.76054
tgtgtttattatccatgatatatttatacaaggagttataataaaaaggaaatgttttaa  c.1210+300

         .         .         .         .         .         .  g.76114
aataatttaactatgagacattagaatttataacttaagtgttaaaagctgtagtttcct  c.1210+360

         .         .         .         .         .         .  g.76174
gtatatgctcaatatactcaatgataatggcacataattttttctctctactcctaataa  c.1210+420

         .         .         .         .         .         .  g.76234
gacaaccagctgctgaacattaaagtgaagtaaagatcaacacagtttataaaatcagag  c.1210+480

         .         .         .         .         .         .  g.76294
atcaaatcagtaaacctaataaagttcgactaagtagaaagttactaacatttttattga  c.1210+540

         .         .         .         .         .         .  g.76354
attaagagaacagttttctttgaatataacatacgctatagtctagatagtttatggcat  c.1210+600

         .         .         .         .         .         .  g.76414
tagaattctaggatgcaaaaactagaggaaggatatttaggagaagtagagaactgcctt  c.1210+660

         .         .         .         .         .         .  g.76474
ataaaacaaggagaagttctgattacagaccatcagtctaggtcccttcagtaaaatatt  c.1210+720

         .         .         .         .         .         .  g.76534
tctagaatgcaaaagaattatagataaatgtagttcaataaacttgtttgttaagaacat  c.1210+780

         .         .         .         .         .         .  g.76594
ccaattcctttttggacagctctgtgtttacctagtctagaacttggtttcacttactag  c.1210+840

         .         .         .         .         .         .  g.76654
gaaaaaactcagaagtttactctttagaaaagcattaccatataatttgaaattatatca  c.1210+900

         .         .         .         .         .         .  g.76714
aaccagtttaaatatttttgtttaaaaggtacttaaatataaatgtgctatttgcttttt  c.1210+960

         .         .         .         .         .         .  g.76774
tcccccagaattctatttaggtcagtattgaaatatttcttgataatcgttagtgaaaat  c.1210+1020

         .         .         .         .         .         .  g.76834
tcatgaatttttttttttttaaagacagaaaagtttgtccttagactccatcagaattac  c.1210+1080

         .         .         .         .         .         .  g.76894
tgaagtggtattttcagtgaaatctcatctctctgtttagtttactgacttgacatcgtg  c.1210+1140

         g.76901
atgttta  c.1210+1147

--------------------- middle of intron ---------------------
                                        g.76902               g.76908
                                        c.1211-1147  tattgac  c.1211-1141

.         .         .         .         .         .           g.76968
tacagtagatttatttctttattacacaactcttagtgaacttgtgtacgttagaataca  c.1211-1081

.         .         .         .         .         .           g.77028
ttgtcaatataaatattcactatgttgttagaaaactaatgttactgtgtatatttatat  c.1211-1021

.         .         .         .         .         .           g.77088
gtacacacatacatatgaagaaaaaataccaatttttcatatgacatattttttctgttg  c.1211-961

.         .         .         .         .         .           g.77148
aactcatttaacatacaagtattttgtttgttaaaacattggtaataacaagatgaataa  c.1211-901

.         .         .         .         .         .           g.77208
gatgtacattctgcctttgtgaggattctactatacagagaggacaattcttcagcttac  c.1211-841

.         .         .         .         .         .           g.77268
tgtagaatatatgacaatgagttctatggtgtacagttggagtactgtgcacagtaggag  c.1211-781

.         .         .         .         .         .           g.77328
tactgtgtacatgggcagttagggaaagtggcattagaacgaggtcttcaaagaatgaga  c.1211-721

.         .         .         .         .         .           g.77388
agagtcagtaagcagaagaaacagactatttcaagatagagagttaggaaagaatattgt  c.1211-661

.         .         .         .         .         .           g.77448
ttagttggagaataacatgaagttgccagtgacaggagattaggtttatgtgcattgagt  c.1211-601

.         .         .         .         .         .           g.77508
gggtaagaaagagaaaatataaaattacagagagtgttgaaagtggagttatggcttagg  c.1211-541

.         .         .         .         .         .           g.77568
gccagattgtgaaggcttcatatatgtggtaagatgtcttaacttgctataacttttaaa  c.1211-481

.         .         .         .         .         .           g.77628
gaaatgcttttatttttaaaagggaaaatgctattatatttggtgcttagaaaaacattt  c.1211-421

.         .         .         .         .         .           g.77688
tttgttgcaatgtaaagtacaaacttgatagtggctatatttggggtaagaatccaaatt  c.1211-361

.         .         .         .         .         .           g.77748
tgggggctattgcagtagtcaaagtaagaagtaaggaatggaaattggattggagagtat  c.1211-301

.         .         .         .         .         .           g.77808
aacataaggaaggaatattttaaccattataataagtaatatgtgattaatgcatgtgtg  c.1211-241

.         .         .         .         .         .           g.77868
gattgaaggcaaaaggaatagagtataatttggctcaacaggatggaatgttggtgccat  c.1211-181

.         .         .         .         .         .           g.77928
ctcttaagatttaaaatgcacgagagagaaggaaatcttttagagaggcatgtcaagatt  c.1211-121

.         .         .         .         .         .           g.77988
ctgtaagtttatctctttggaaatgtctaaaatgtctaaagtctaaaaaataatgaactg  c.1211-61

.         .         .         .         .         .           g.78048
tgtcaaaaatcttgatgtaccataactgttttgtgcatttggttttctttcttttcttag  c.1211-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center