ADP-ribosylation factor-like 13B (ARL13B) - 156 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.78222
gtgaactgggacattcttctttctcagaagaagaaacatcttgtaaattgatgactgggg  c.1324+60

         .          g.78240
caagataaccataataat  c.1324+78

--------------------- middle of intron ---------------------
                               g.78241            .           g.78258
                               c.1325-78  tttagtgagaagattaat  c.1325-61

.         .         .         .         .         .           g.78318
actcaaggacctgacttgataattacttatttgtgtttttcatggttaaaaaaataaaag  c.1325-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center