ADP-ribosylation factor-like 2 binding protein (ARL2BP) - coding DNA reference sequence

(used for variant description)

(last modified December 19, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_012106.3 in the ARL2BP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_033905.1, covering ARL2BP transcript NM_012106.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5002
                                                           ag       c.-241

 .         .         .         .         .         .                g.5062
 tcaccgaggcccggacctgcggcgtcggcggcgcgcgcagagggccaggcgggcgtagag       c.-181

 .         .         .         .         .         .                g.5122
 gccggaccgacgcgtggcggcagagggtatccaaggccggacctggcgcgcaggcgctga       c.-121

 .         .         .         .         .         .                g.5182
 cccgacctggcagtgagctggccgcggccttggctgagaggccttaaccccgccgggcgg       c.-61

 .         .         .         .         .         .                g.5242
 ccgcgccctgcatgcgagttgggccgcgggcggggttggagcctactcggggcgactgcg       c.-1

          .         .         .         | 02         .         .    g.5976
 ATGGACGCCTTAGAAGGAGAGAGCTTTGCGCTGTCTTT | CTCCTCCGCCTCTGATGCAGAA    c.60
 M  D  A  L  E  G  E  S  F  A  L  S  F  |  S  S  A  S  D  A  E      p.20

          .         .         .         . | 03       .         .    g.8431
 TTTGATGCTGTGGTTGGATATTTAGAGGACATTATCATGG | ATGACGAGTTCCAGTTATTA    c.120
 F  D  A  V  V  G  Y  L  E  D  I  I  M  D |   D  E  F  Q  L  L      p.40

          .         .         .         .         .         .       g.8491
 CAGAGAAATTTCATGGACAAGTACTACCTGGAGTTTGAAGACACAGAAGAGAATAAACTC       c.180
 Q  R  N  F  M  D  K  Y  Y  L  E  F  E  D  T  E  E  N  K  L         p.60

          .         .        | 04.         .         .         .    g.9674
 ATCTACACACCTATTTTTAATGAATAC | ATTTCTTTGGTAGAAAAATACATTGAAGAACAG    c.240
 I  Y  T  P  I  F  N  E  Y   | I  S  L  V  E  K  Y  I  E  E  Q      p.80

          .         .         .         .         .    | 05    .    g.10292
 CTGCTGCAGCGGATTCCTGAGTTCAACATGGCAGCCTTCACCACAACATTACA | GCACCAT    c.300
 L  L  Q  R  I  P  E  F  N  M  A  A  F  T  T  T  L  Q  |  H  H      p.100

          .         .         .         .         .         .       g.10352
 AAGGATGAAGTGGCTGGTGACATATTCGACATGCTGCTCACCTTCACAGATTTTCTGGCT       c.360
 K  D  E  V  A  G  D  I  F  D  M  L  L  T  F  T  D  F  L  A         p.120

          .         .         . | 06       .         .         .    g.12070
 TTTAAAGAAATGTTTTTGGACTACAGAGCA | GAAAAAGAAGGCCGAGGACTGGACTTAAGC    c.420
 F  K  E  M  F  L  D  Y  R  A   | E  K  E  G  R  G  L  D  L  S      p.140

          .         .         .         .         .         .       g.12130
 AGTGGCTTAGTGGTGACTTCATTGTGCAAATCATCTTCTCTGCCAGCTTCCCAGAACAAT       c.480
 S  G  L  V  V  T  S  L  C  K  S  S  S  L  P  A  S  Q  N  N         p.160

          .                                                         g.12142
 CTGCGGCACTAG                                                       c.492
 L  R  H  X                                                         p.163

          .         .         .         .         .         .       g.12202
 gtcctacctccagccaatgaatgggatcattctggatgtcaccagcccaataggctcagc       c.*60

          .         .         .         .         .         .       g.12262
 tcatgatgacagaacacatcttggaaagactgactctgttatgtaactcttcatttatgt       c.*120

          .         .         .         .         .         .       g.12322
 taagtattaataggtcaaaaccaaaatgacctaaccctcctggacctatttatcctgaaa       c.*180

          .         .         .         .         .         .       g.12382
 caccttcttgtattcattaaccatagtactcctccccacctcaagtagacacctctctca       c.*240

          .         .         .         .         .         .       g.12442
 ggagcttctgagtcagacgcctctggagcgagccctatgtcaggcactccacctgggggg       c.*300

          .         .         .         .         .         .       g.12502
 cccttccccagcatacctgctggtgtgtaagtgtggactaacccgccgccaccaccctct       c.*360

          .         .         .         .         .         .       g.12562
 gttccagcaggctctgcatgaatctttgtgcacttgcacctctttttcacatgggccaca       c.*420

          .         .         .         .         .         .       g.12622
 gtttcagtacttcagcctcagtggggttcctgatgtttatctagggtgttactcaagccc       c.*480

          .         .         .         .         .         .       g.12682
 agtttgagattttggagtctcctgtgatcacatcttgtctcggctgtaggaatcaacaga       c.*540

          .         .         .         .         .         .       g.12742
 aggagacgtcctctacataaaagctccatgtgaaaagctactcctagtcttaacatttgc       c.*600

          .         .         .         .         .         .       g.12802
 agtccttgtgtcactgtcttctggtcctgatgtagtcccactgtttctagaagtctcttt       c.*660

          .         .         .         .         .         .       g.12862
 taagcattatttttgaaaaaaaaaatatttttatagatgaatactcaggctaacctagtg       c.*720

          .         .         .         .         .         .       g.12922
 gatgtgatcttggaacttccatgattatccacttaaagatcaaagtattatatgctgtgt       c.*780

          .         .         .         .         .         .       g.12982
 gctttttaggtgtttgttagtactgtgaaggcaaaaatgctttctacattgacattcatt       c.*840

          .         .         .         .         .         .       g.13042
 cctattttactgggcacctatgaatgtatgctgtgtgctagaaatagactaaaacatatt       c.*900

          .         .         .         .         .         .       g.13102
 cctatagcatgttagtgtgtttgcatgtttgctgaaaatcctttgtgtataaaccagttt       c.*960

          .         .         .         .         .         .       g.13162
 gtaaggttctctgggttaggtagggactctgcagtttcttcctgtcaaaatctctcctac       c.*1020

          .         .         .         .         .         .       g.13222
 caagatggtgttccactgtccagcccagcatgagtagcaggtagagcacagctttactgg       c.*1080

          .         .         .         .         .         .       g.13282
 ctgtttgtatgctttggtttagtgcaatgtgtggtagattacttatcagaaaacatatat       c.*1140

          .         .         .         .         .         .       g.13342
 gtcatctctagaacgaagaaaaagcatagtagttcaattcccagtgtgtccctttgattt       c.*1200

          .         .         .         .         .         .       g.13402
 tttttttttaatagtaaaaataagaatctgtactgacttttcacttggccattctggttt       c.*1260

          .         .         .         .         .         .       g.13462
 taaaggacaagctacaagctctgtgtttctgtactgatgtgtcacttattaaatactttt       c.*1320

          .         .         .         .                           g.13508
 gtaccatgagtaaaacttcaggtgtttcgcaagaaccaccattctc                     c.*1366

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The ADP-ribosylation factor-like 2 binding protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.