ADP-ribosylation factor-like 3 (ARL3) - coding DNA reference sequence

(used for variant description)

(last modified August 24, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_004311.3 in the ARL3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering ARL3 transcript NM_004311.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5038
                       gcgcactctggggaaagcggagctgcaccccgccccgt       c.-121

 .         .         .         .         .         .                g.5098
 attgctgctcagctcctcagctgtgcgtgcgagggacgtcgggggcggcgccgcagcagt       c.-61

 .         .         .         .         .         .                g.5158
 tgcccctggtaacgggggaggcagcaggaggaggaggaggaggagggactcggcgggagg       c.-1

     | 02    .         .         .         .         .         .    g.14001
 ATG | GGCTTGCTCTCAATTTTGCGCAAGTTGAAAAGTGCACCAGACCAGGAGGTGAGAATA    c.60
 M   | G  L  L  S  I  L  R  K  L  K  S  A  P  D  Q  E  V  R  I      p.20

          .         .         .         .         .         .       g.14061
 CTTCTCCTGGGCTTGGATAATGCTGGCAAGACCACTCTTCTGAAGCAGCTTGCATCTGAA       c.120
 L  L  L  G  L  D  N  A  G  K  T  T  L  L  K  Q  L  A  S  E         p.40

          .         .        | 03.         .         .         .    g.19977
 GACATCAGCCACATCACACCTACACAG | GGTTTCAACATCAAAAGTGTACAATCACAAGGT    c.180
 D  I  S  H  I  T  P  T  Q   | G  F  N  I  K  S  V  Q  S  Q  G      p.60

          .         .         .         .         .         .       g.20037
 TTTAAACTGAATGTATGGGACATTGGTGGACAGAGGAAAATCAGACCATACTGGAAGAAT       c.240
 F  K  L  N  V  W  D  I  G  G  Q  R  K  I  R  P  Y  W  K  N         p.80

          .         .     | 04   .         .         .         .    g.29526
 TATTTTGAAAATACCGATATTCTT | ATATATGTAATCGACAGTGCAGACAGAAAAAGATTT    c.300
 Y  F  E  N  T  D  I  L   | I  Y  V  I  D  S  A  D  R  K  R  F      p.100

          .      | 05  .         .         .         .         .    g.33477
 GAAGAGACGGGTCAG | GAACTAGCGGAATTACTGGAGGAAGAAAAACTAAGTTGTGTGCCA    c.360
 E  E  T  G  Q   | E  L  A  E  L  L  E  E  E  K  L  S  C  V  P      p.120

          .         .         .         .         .         .       g.33537
 GTGCTCATCTTTGCTAATAAGCAGGATTTGCTCACAGCAGCCCCTGCCTCTGAAATTGCA       c.420
 V  L  I  F  A  N  K  Q  D  L  L  T  A  A  P  A  S  E  I  A         p.140

          .         .         .         .         .         .       g.33597
 GAAGGACTGAACCTGCATACCATCCGCGACCGAGTCTGGCAGATCCAGTCTTGCTCAGCT       c.480
 E  G  L  N  L  H  T  I  R  D  R  V  W  Q  I  Q  S  C  S  A         p.160

          .         .  | 06      .         .         .         .    g.42531
 CTCACAGGAGAGGGCGTTCAG | GATGGCATGAACTGGGTCTGCAAAAATGTCAATGCAAAG    c.540
 L  T  G  E  G  V  Q   | D  G  M  N  W  V  C  K  N  V  N  A  K      p.180

                                                                    g.42540
 AAGAAATAA                                                          c.549
 K  K  X                                                            p.182

          .         .         .         .         .         .       g.42600
 aatctagacgaatggagatgcaggagctgcgggagccgaattcggtcctgaaaaacacta       c.*60

          .         .         .         .         .         .       g.42660
 atttgctgctttctgaccaaatgtttttccatctgtgtacagctccagctgtttgaagag       c.*120

          .         .         .         .         .         .       g.42720
 agggaacaacacggtttagaaagaatccccattccagcagtagatttaactgatctctga       c.*180

          .         .         .         .         .         .       g.42780
 ggttcagtatcatttttcaaataaaggaattatattatttcctctgcataattgaaatag       c.*240

          .         .         .         .         .         .       g.42840
 tattaaatgtctcaaagcacatgattagaaaatgagatcttttaaatgagcaagagattg       c.*300

          .         .         .         .         .         .       g.42900
 cattgcagtttagacaattccagtgggcttttttttcctctcaaaaaaaaaaaaagaaaa       c.*360

          .         .         .         .         .         .       g.42960
 agaaaaagaggaagaagcagctttgctgagttcatttatttactgacccgtcccttgcat       c.*420

          .         .         .         .         .         .       g.43020
 tccctccatggttttgaaaccacagacagtgtttgctggtgctgtcagtgatttttaccg       c.*480

          .         .         .         .         .         .       g.43080
 tcactagcccagccaggcttcagtctgtccgacaggaagctgctgggtgggggtgggggg       c.*540

          .         .         .         .         .         .       g.43140
 agaaaaggcagataattaaaccatctcatcgtcttgcaggtcggagactacgtatgtaat       c.*600

          .         .         .         .         .         .       g.43200
 cctcactctttggacagaaaaaaaaaaaaaagtctttcttgcagacaagtcactacagaa       c.*660

          .         .         .         .         .         .       g.43260
 acataccccatcccacccacccctgcctctgccccagccagccacacagagaagcaaatt       c.*720

          .         .         .         .         .         .       g.43320
 cttatgacttttgactgtaatgacatctggaatgtaaggagaggtgggaggtttaattcc       c.*780

          .         .         .         .         .         .       g.43380
 agaaaaattacaaggtccttaaaaagctctcacatcgagggctcaggctagcgtaaacag       c.*840

          .         .         .         .         .         .       g.43440
 gctttctccagctcagtggagcagtgagcagccgactctgagattagctggcttctccac       c.*900

          .         .         .         .         .         .       g.43500
 ggccgtcctatagacaggatttctaaagctcaaagaattctgtgtttaaacgatcacaat       c.*960

          .         .         .         .         .         .       g.43560
 aggccgctgctatcagattttagaaataaatgcagctttaccatgaacctgctccactga       c.*1020

          .         .         .         .         .         .       g.43620
 gaaaagccaggcagatcgatttttagatcaatttttacagtgctggcaacttggtggtgt       c.*1080

          .         .         .         .         .         .       g.43680
 gggatgctcctggatggagagggtttgctgctggggaggacatgggtgtgtgtgtgactg       c.*1140

          .         .         .         .         .         .       g.43740
 caggggtcgtgtccaaggaatcaagagtcaccccagctgctgggctcctctgcctctctg       c.*1200

          .         .         .         .         .         .       g.43800
 cagcagaatgtccgtcctctgttgattgattggagaggaatagcagaacatttctcctgc       c.*1260

          .         .         .         .         .         .       g.43860
 ccctcgttgcaaaacgagcttgtttccctgaacctcagaaatcctcagcttcaaacatgg       c.*1320

          .         .         .         .         .         .       g.43920
 ggaaacaggccagagcattgcccggctcctgaattaaactctgttctggtgcctgagctc       c.*1380

          .         .         .         .         .         .       g.43980
 aggggttttcagagaatgaataagagactgtccagtgactggtgggtccctgggggccag       c.*1440

          .         .         .         .         .         .       g.44040
 ctgccttctcatcctgggaggtggcccttcccaagcccatcagggcgtgtgagcagactg       c.*1500

          .         .         .         .         .         .       g.44100
 aaggggccgctgcagcccctggccctcaatacccagctgcttctggctaagagtgcagca       c.*1560

          .         .         .         .         .         .       g.44160
 gagactgaggcatagccagcttcaaaagcgatctgacatgaaagtcattaacaaagccag       c.*1620

          .         .         .         .         .         .       g.44220
 ccgtgaaaaggtgccccagagttgctgtggacagacctgtaaggacttgcaaaacaaaag       c.*1680

          .         .         .         .         .         .       g.44280
 aaagtgaggggtttttttaacctcagagctagctgctctctgcagcctcctccactggct       c.*1740

          .         .         .         .         .         .       g.44340
 tctctggctcacccaagctctcccttacagaggcaacacagaattataaggaatcagaaa       c.*1800

          .         .         .         .         .         .       g.44400
 tcccccttctaccaggctgcaaatgtggctctagcacttgcaaattgttttttcttccga       c.*1860

          .         .         .         .         .         .       g.44460
 atagttcagcagggacaagttatctgaggggcaaaatgcctgcttggaggtctgcaattt       c.*1920

          .         .         .         .         .         .       g.44520
 tggaacactgcagtatggaactttggcattggagggtctgtaaaatatttttgttctttt       c.*1980

          .         .         .         .         .         .       g.44580
 accaccaacttaggggactgttttaaagagccatcccaaggcctctcctagcaggcagaa       c.*2040

          .         .         .         .         .         .       g.44640
 gccactcctctgataacggcctctgtaaatgttctgatttgctctcagctgcagagacac       c.*2100

          .         .         .         .         .         .       g.44700
 agagacactgcagatgtcacacgctttcatcttccctttgagcccttttgaaccctcctg       c.*2160

          .         .         .         .         .         .       g.44760
 gggctctggggtagatgagagaagcctgaaaaaggcagagtttgaaagctcccatttaaa       c.*2220

          .         .         .         .         .         .       g.44820
 aacaaaatactttttaaagccctcttgcctcttccctgcccactcctgccccctgaccag       c.*2280

          .         .         .         .         .         .       g.44880
 aagacagaatttgaagctggaaagggaagaccccttttcccctcctcctgtccccagtga       c.*2340

          .         .         .         .         .         .       g.44940
 gtcttagcgagacttttgccctgcgcacaattgcatctgaatgtgcgggggagagggctg       c.*2400

          .         .         .         .         .         .       g.45000
 ggggccggagggcaggcaaggcctggggggtgctcgtgatatgtgctcaagccagttgtg       c.*2460

          .         .         .         .         .         .       g.45060
 ggaaaaactcgagtcctcccctcctcccgacctaccccgtgtggctgcttttggctggat       c.*2520

          .         .         .         .         .         .       g.45120
 tccctgcacccagtgcaacacaccctttccccttcactctcccttggttactatggaaac       c.*2580

          .         .         .         .         .         .       g.45180
 aagggtgtcattgatgtgggctgagctggggaacatgtcggtgcacagctgaaagtcagc       c.*2640

          .         .         .         .         .         .       g.45240
 gattatgccggcggttagaaatgtgccagggttaaaggagtccgcagctcccacggctgc       c.*2700

          .         .         .         .         .         .       g.45300
 tgggaggacatggtcctgcccccttccttcctccctccctccgtctccacttctctctcc       c.*2760

          .         .         .         .         .         .       g.45360
 ttgcttttgacaaatttctttattcccctctggactaaagtagtggctatttttgtgcca       c.*2820

          .         .         .         .         .         .       g.45420
 ctctgcgccccaccctcactgttggccgctccttatccggcctggcctggagggtgacac       c.*2880

          .         .         .         .         .         .       g.45480
 catgtcaccctcaccaggactcgtctctccattcccgtcagagtttgctttgatttccct       c.*2940

          .         .         .         .         .         .       g.45540
 ttcctttccttctcggggaccagttcttacttccttttatttttagctctgcactccatg       c.*3000

          .         .         .         .         .         .       g.45600
 tggtttcagggttcagtctgatccatcaaaaggttctttttttataatcccttttgaaaa       c.*3060

          .         .         .         .         .         .       g.45660
 tgataatcaaaggaagagatgtggtgtttggtcatgtggaaaactcaatgtataatttag       c.*3120

          .         .         .         .                           g.45707
 acgtctgtcaaaaatccgacaaataaaatttagctggaacgaaggca                    c.*3167

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The ADP-ribosylation factor-like 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.