ADP-ribosylation factor-like 6 interacting protein 1 (ARL6IP1) - coding DNA reference sequence

(used for variant description)

(last modified October 9, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_015161.1 in the ARL6IP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering ARL6IP1 transcript NM_015161.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5009
                                                    gtgcgggtt       c.-61

 .         .         .         .         .         .                g.5069
 tcggttggaggactcgttggggaggtggcctgcgcttgtagagactgcatccccgagacg       c.-1

          .         .         .       | 02 .         .         .    g.7725
 ATGGCGGAGGGAGATAATCGCAGCACCAACCTGCTG | GCTGCAGAGACTGCAAGTCTGGAA    c.60
 M  A  E  G  D  N  R  S  T  N  L  L   | A  A  E  T  A  S  L  E      p.20

          .         .         .         .         .         .       g.7785
 GAACAGCTGCAAGGATGGGGAGAAGTGATGCTGATGGCTGATAAAGTCCTCCGATGGGAA       c.120
 E  Q  L  Q  G  W  G  E  V  M  L  M  A  D  K  V  L  R  W  E         p.40

          .         .         .         .         . | 03       .    g.8501
 AGAGCCTGGTTTCCACCTGCCATCATGGGTGTGGTTTCTTTGGTGTTTCT | GATTATCTAC    c.180
 R  A  W  F  P  P  A  I  M  G  V  V  S  L  V  F  L  |  I  I  Y      p.60

          .         .         .         .         .         .       g.8561
 TATCTAGATCCATCTGTTCTGTCCGGCGTTTCCTGTTTTGTTATGTTTTTGTGCTTGGCT       c.240
 Y  L  D  P  S  V  L  S  G  V  S  C  F  V  M  F  L  C  L  A         p.80

          .         .         .         .         . | 04       .    g.10964
 GACTACCTTGTTCCCATTCTAGCGCCTAGAATTTTTGGCTCCAATAAATG | GACCACTGAA    c.300
 D  Y  L  V  P  I  L  A  P  R  I  F  G  S  N  K  W  |  T  T  E      p.100

          .         .         .         .         .         .       g.11024
 CAACAGCAAAGATTCCATGAAATTTGCAGCAATCTAGTAAAAACTCGACGCAGAGCTGTG       c.360
 Q  Q  Q  R  F  H  E  I  C  S  N  L  V  K  T  R  R  R  A  V         p.120

          .         .         .         .         | 05         .    g.11864
 GGTTGGTGGAAACGCCTCTTCACACTAAAGGAAGAAAAACCTAAGATG | TACTTCATGACC    c.420
 G  W  W  K  R  L  F  T  L  K  E  E  K  P  K  M   | Y  F  M  T      p.140

          .         .         .         .         .         .       g.11924
 ATGATCGTTTCCCTTGCTGCGGTTGCTTGGGTGGGACAACAAGTCCACAACCTGCTTCTC       c.480
 M  I  V  S  L  A  A  V  A  W  V  G  Q  Q  V  H  N  L  L  L         p.160

          .    | 06    .         .         .         .         .    g.13212
 ACCTACCTGATAG | TGACTTCCTTACTATTGCTTCCTGGACTAAACCAACATGGAATCATT    c.540
 T  Y  L  I  V |   T  S  L  L  L  L  P  G  L  N  Q  H  G  I  I      p.180

          .         .         .         .         .         .       g.13272
 TTGAAGTACATTGGAATGGCCAAGAGGGAGATAAACAAACTTCTCAAACAAAAAGAAAAG       c.600
 L  K  Y  I  G  M  A  K  R  E  I  N  K  L  L  K  Q  K  E  K         p.200

          .                                                         g.13284
 AAAAACGAATGA                                                       c.612
 K  N  E  X                                                         p.203

          .         .         .         .         .         .       g.13344
 ttcatctgctttaatcagtgtgattaatgcagcacccattgccccgggaaccgtttctgc       c.*60

          .         .         .         .         .         .       g.13404
 tgtactatctggatactaaaatgttacggaagtagctctttgttctccctcactctgccc       c.*120

          .         .         .         .         .         .       g.13464
 ttagttaatagaaattcagactcgccaagtaaggcttcgtgcatagtgtcttcatgtcgc       c.*180

          .         .         .         .         .         .       g.13524
 gtatagttgagcgcgttcttagcagttggcttcatggacaactcattagtgttttgactt       c.*240

          .         .         .         .         .         .       g.13584
 ttcttacccagcgttaattgaattcttgcttttagacaacttcctttttgtagtggtgaa       c.*300

          .         .         .         .         .         .       g.13644
 ccttgccctttagtacagttcaagtgaatctggataattgttcatctttgctttagctta       c.*360

          .         .         .         .         .         .       g.13704
 gataccatgtagtggtctgtggctacaggaagctggttctgtctgcttccacagtctgct       c.*420

          .         .         .         .         .         .       g.13764
 taaaaaactgtctgacttcgtgaatatagagaccaagtttaccacttctgatgaagagac       c.*480

          .         .         .         .         .         .       g.13824
 caattaagattcattcctcattctgtttctttccagtgggagaagagtccccatgaaata       c.*540

          .         .         .         .         .         .       g.13884
 agatgaaactgattccatgcactagtacatgtaggcttctcccttgtgcaaagcttagca       c.*600

          .         .         .         .         .         .       g.13944
 atttgtaggaaactttgatctttttgtccaagaaaaggaatgtctgacaggcttaagctt       c.*660

          .         .         .         .         .         .       g.14004
 tcgtccccttgcacttagactcgaagttagtaaatccttaaaggctttttaatagcagac       c.*720

          .         .         .         .         .         .       g.14064
 ttccaaaagattgcatttaggatttctagcatgcttttaatttcagattttcagctgaca       c.*780

          .         .         .         .         .         .       g.14124
 ttagctatagtatacagtaggttaagactcatgtctatgactttcactctaagactggca       c.*840

          .         .         .         .         .         .       g.14184
 aaaggacagcagtcttctatgtttagtcaatattcatttcagtagaagataatcttatct       c.*900

          .         .         .         .         .         .       g.14244
 aatttttgagaccagaataagccttttaaggtaaacctcaaaattatcattttatggtaa       c.*960

          .         .         .         .         .         .       g.14304
 tactgaccattttagtcccctaggtttgacatgggagatagtgactacactggtgtctga       c.*1020

          .         .         .         .         .         .       g.14364
 cttttttcctagagatttctccctgaaaaatacaagggctgttggtgagagcagacttga       c.*1080

          .         .         .         .         .         .       g.14424
 ggtgatgatagttggcctctggtctacaaagatttcataactccttggaaagcttcttat       c.*1140

          .         .         .         .         .         .       g.14484
 aatcattcttaacttcttggtagctagaaatttagagtagttgaaatctttaggaatgaa       c.*1200

          .         .         .         .         .         .       g.14544
 cttctgagggccaaaaaatgtgactgacgggaacaattcttaaactgattaactagctgt       c.*1260

          .         .         .         .         .         .       g.14604
 aatatagttttgtgaatttattgcactgatgttgtaccttgtggtatatctgtccctatt       c.*1320

          .         .         .         .         .         .       g.14664
 aaataagtgttgttttctcctctttaatattgctgtgaacagtggtgcccattgtagcat       c.*1380

          .         .         .         .         .         .       g.14724
 atgtttgatttttttttattatttcataagaaaactacgttaattttaccttactttcat       c.*1440

          .         .         .         .         .         .       g.14784
 tgtaaataagcctgtcttcctatctggattttttgtgtgcatacatattctactgattaa       c.*1500

          .         .         .         .         .         .       g.14844
 ctacttttgcagttttaatcctgtattatttcttctactttgttttgtgtaaaaggggaa       c.*1560

          .         .                                               g.14867
 aaaataaaaaaagctggaatctt                                            c.*1583

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The ADP-ribosylation factor-like 6 interacting protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.