aspartic peptidase, retroviral-like 1 (ASPRV1) - coding DNA reference sequence

(used for variant description)

(last modified June 8, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_152792.2 in the ASPRV1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_054918.1, covering ASPRV1 transcript NM_152792.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5037
                        gcagcagttgagtccatgtaagatgattgtgcacgtg       c.-541

 .         .         .         .         .         .                g.5097
 tgtgtgtgtgtgtgtgtgtgtgtgtgtgtcctcactcacttaaaaaagaccatttctgtg       c.-481

 .         .         .         .         .         .                g.5157
 cattctttatgctggaaccctcctctgcctccctctccaggaaatcccataggatcccat       c.-421

 .         .         .         .         .         .                g.5217
 acctgctttagaatgtgtgtgagacacttcccagtgcctggcatgtggtaggagctcagt       c.-361

 .         .         .         .         .         .                g.5277
 acatgtaaactgttttcctttgaccactcaaagtagtcacttgttggggaggccaatggc       c.-301

 .         .         .         .         .         .                g.5337
 ggcttccccggtctctgagctgatgggcgtctggtccctgcctccccttccttcactggc       c.-241

 .         .         .         .         .         .                g.5397
 tgatgacaaatacctgaatgtcatcacatcctccgtgtcctcatctgttattctggaaca       c.-181

 .         .         .         .         .         .                g.5457
 caggccagggagggtacagggtagtcccccttcaacagaggctggcctttcttgggatgt       c.-121

 .         .         .         .         .         .                g.5517
 gggctggctggtgttggtccaaggatggatgcagagggtgaggcacccatcctgctagtc       c.-61

 .         .         .         .         .         .                g.5577
 cggccggatgctggcaggagggcggggtgaggaggggcggagcttccagaacaaaggaga       c.-1

          .         .         .         .         .         .       g.5637
 ATGGGGAGCCCAGGGGCCAGCCTAGGCATCAAAAAGGCTCTGCAGAGTGAACAGGCCACA       c.60
 M  G  S  P  G  A  S  L  G  I  K  K  A  L  Q  S  E  Q  A  T         p.20

          .         .         .         .         .         .       g.5697
 GCACTGCCTGCCTCTGCCCCAGCAGTCAGCCAGCCGACCGCGCCTGCTCCCTCCTGCTTG       c.120
 A  L  P  A  S  A  P  A  V  S  Q  P  T  A  P  A  P  S  C  L         p.40

          .         .         .         .         .         .       g.5757
 CCCAAGGCCGGGCAAGTCATCCCCACTCTGCTTCGAGAGGCCCCGTTTTCCAGCGTGATT       c.180
 P  K  A  G  Q  V  I  P  T  L  L  R  E  A  P  F  S  S  V  I         p.60

          .         .         .         .         .         .       g.5817
 GCGCCGACACTGCTCTGTGGGTTTCTCTTCTTGGCGTGGGTTGCTGCTGAGGTTCCAGAG       c.240
 A  P  T  L  L  C  G  F  L  F  L  A  W  V  A  A  E  V  P  E         p.80

          .         .         .         .         .         .       g.5877
 GAGAGCAGCAGGATGGCCGGGAGCGGAGCCAGGAGTGAGGAAGGCCGCCGGCAGCATGCC       c.300
 E  S  S  R  M  A  G  S  G  A  R  S  E  E  G  R  R  Q  H  A         p.100

          .         .         .         .         .         .       g.5937
 TTCGTCCCGGAACCTTTTGATGGGGCCAATGTCGTCCCAAACCTCTGGCTGCACAGCTTT       c.360
 F  V  P  E  P  F  D  G  A  N  V  V  P  N  L  W  L  H  S  F         p.120

          .         .         .         .         .         .       g.5997
 GAAGTCATCAATGACCTCAACCATTGGGACCATATCACCAAGCTAAGGTTCCTGAAAGAG       c.420
 E  V  I  N  D  L  N  H  W  D  H  I  T  K  L  R  F  L  K  E         p.140

          .         .         .         .         .         .       g.6057
 TCCCTCAGAGGAGAGGCCCTGGGTGTCTACAATAGGCTCAGTCCCCAGGACCAGGGAGAC       c.480
 S  L  R  G  E  A  L  G  V  Y  N  R  L  S  P  Q  D  Q  G  D         p.160

          .         .         .         .         .         .       g.6117
 TATGGGACTGTGAAAGAGGCCCTCCTGAAGGCCTTTGGGGTCCCTGGGGCTGCCCCCAGC       c.540
 Y  G  T  V  K  E  A  L  L  K  A  F  G  V  P  G  A  A  P  S         p.180

          .         .         .         .         .         .       g.6177
 CACCTGCCCAAAGAGATCGTCTTTGCCAACAGCATGGGTAAGGGCTACTATCTCAAGGGG       c.600
 H  L  P  K  E  I  V  F  A  N  S  M  G  K  G  Y  Y  L  K  G         p.200

          .         .         .         .         .         .       g.6237
 AAGATTGGCAAAGTGCCCGTGAGGTTCCTGGTGGACTCTGGGGCCCAGGTCTCTGTGGTC       c.660
 K  I  G  K  V  P  V  R  F  L  V  D  S  G  A  Q  V  S  V  V         p.220

          .         .         .         .         .         .       g.6297
 CACCCAAACTTGTGGGAGGAGGTCACTGATGGCGATCTGGACACCCTGCAGCCCTTTGAG       c.720
 H  P  N  L  W  E  E  V  T  D  G  D  L  D  T  L  Q  P  F  E         p.240

          .         .         .         .         .         .       g.6357
 AATGTGGTAAAGGTGGCCAATGGTGCTGAAATGAAGATCCTGGGTGTCTGGGATACAGCG       c.780
 N  V  V  K  V  A  N  G  A  E  M  K  I  L  G  V  W  D  T  A         p.260

          .         .         .         .         .         .       g.6417
 GTGTCCCTAGGCAAGCTGAAGCTGAAGGCACAGTTCCTAGTGGCCAATGCGAGTGCCGAG       c.840
 V  S  L  G  K  L  K  L  K  A  Q  F  L  V  A  N  A  S  A  E         p.280

          .         .         .         .         .         .       g.6477
 GAAGCCATCATTGGCACTGATGTGCTCCAGGACCACAATGCTATCCTGGACTTTGAGCAC       c.900
 E  A  I  I  G  T  D  V  L  Q  D  H  N  A  I  L  D  F  E  H         p.300

          .         .         .         .         .         .       g.6537
 CGCACATGCACCCTGAAAGGGAAGAAGTTTCGCCTTCTGCCTGTGGGAGGGTCCCTGGAA       c.960
 R  T  C  T  L  K  G  K  K  F  R  L  L  P  V  G  G  S  L  E         p.320

          .         .         .         .         .         .       g.6597
 GATGAGTTTGACCTGGAGCTCATAGAGGAGGACCCCTCCTCAGAAGAAGGGCGGCAGGAG       c.1020
 D  E  F  D  L  E  L  I  E  E  D  P  S  S  E  E  G  R  Q  E         p.340

          .                                                         g.6609
 CTATCCCACTGA                                                       c.1032
 L  S  H  X                                                         p.343

          .         .         .         .         .         .       g.6669
 gaagccaccttttctttaacctcctaaatattggtgggaagacccaccgctgtggggggg       c.*60

          .         .         .         .         .         .       g.6729
 gttgcatatcctcatgggggtcactgggcttggccagtctgcttatcaactcttgctctt       c.*120

          .         .         .         .         .         .       g.6789
 ctctcccctttgcctccctctgcaggggccttaatctgcccctggtaggggaggcttcca       c.*180

          .         .         .         .         .         .       g.6849
 ctgaacaggcacaggtgagggagagcaggctggcttagagggacagggtccccatggtca       c.*240

          .         .         .         .         .         .       g.6909
 tcaagctgctgttgatgacaaagactcaaaggctggaagagctcccaaggaagctagaaa       c.*300

          .         .         .         .         .         .       g.6969
 tgcttgtctttgaaagaactgtgggaccccttcagattccctgaggtatggcttggtcac       c.*360

          .         .         .         .         .         .       g.7029
 tctcaggtcctcaaagcctgtcttagttgggctgggtcctagctgcagggtctttgtgag       c.*420

          .         .         .         .         .         .       g.7089
 ggtcacagttgctctgggacacctccctgaagagcctttccacctgtacaatcgtatttt       c.*480

          .         .         .         .         .         .       g.7149
 ctttctgtcatttgctttgaagcccattgtgccttatgccaataattcaattgctgcaaa       c.*540

          .         .                                               g.7177
 caccaataaagattgattcatggaaaaa                                       c.*568

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Aspartic peptidase, retroviral-like 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.