argininosuccinate synthase 1 (ASS1) - coding DNA reference sequence

(used for variant description)

(last modified July 29, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_000050.4 in the ASS1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011542.1, covering ASS1 transcript NM_000050.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5056
     gccggcgcgcccctgggagggtgagccggcgccgggcccaggcccggacctggtgg       c.-301

 .         .         .         .         .         .                g.5116
 gaggcggggggaggtggggacgaggcctggggaggcgggccccgcccatctgcaggtggc       c.-241

 .         .         .         .         .         .                g.5176
 tgtgaacgctgagcggctccaggcgggggccgggcccgggggcggggtctgtggcgcgcg       c.-181

 .         .         .         .         .         .                g.5236
 tccccgccacgtgtccccggtcaccggccctgcccccgggccctgtgcttataacctggg       c.-121

 .         .         .         .         .         .   | 02         g.10572
 atgggcacccctgccagtcctgctctgccgcctgccaccgctgcccgagcccg | agtggtt    c.-61

 .         .         .         .         .         .     | 03       g.12522
 cactgcactgtgaaaacagattccagacgccgggaactcacgcctccaatcccag | acgct    c.-1

          .         .         .         .         .         .       g.12582
 ATGTCCAGCAAAGGCTCCGTGGTTCTGGCCTACAGTGGCGGCCTGGACACCTCGTGCATC       c.60
 M  S  S  K  G  S  V  V  L  A  Y  S  G  G  L  D  T  S  C  I         p.20

          .         .         .         .      | 04  .         .    g.14613
 CTCGTGTGGCTGAAGGAACAAGGCTATGACGTCATTGCCTATCTG | GCCAACATTGGCCAG    c.120
 L  V  W  L  K  E  Q  G  Y  D  V  I  A  Y  L   | A  N  I  G  Q      p.40

          .         .         .         .         .     | 05   .    g.18700
 AAGGAAGACTTCGAGGAAGCCAGGAAGAAGGCACTGAAGCTTGGGGCCAAAAAG | GTGTTC    c.180
 K  E  D  F  E  E  A  R  K  K  A  L  K  L  G  A  K  K   | V  F      p.60

          .         .         .         .         .         .       g.18760
 ATTGAGGATGTCAGCAGGGAGTTTGTGGAGGAGTTCATCTGGCCGGCCATCCAGTCCAGC       c.240
 I  E  D  V  S  R  E  F  V  E  E  F  I  W  P  A  I  Q  S  S         p.80

          .         .         .         .         .         .       g.18820
 GCACTGTATGAGGACCGCTACCTCCTGGGCACCTCTCTTGCCAGGCCCTGCATCGCCCGC       c.300
 A  L  Y  E  D  R  Y  L  L  G  T  S  L  A  R  P  C  I  A  R         p.100

          .         .         .         .         .         .       g.18880
 AAACAAGTGGAAATCGCCCAGCGGGAGGGGGCCAAGTATGTGTCCCACGGCGCCACAGGA       c.360
 K  Q  V  E  I  A  Q  R  E  G  A  K  Y  V  S  H  G  A  T  G         p.120

     | 06    .         .         .         .         .         .    g.24461
 AAG | GGGAACGATCAGGTCCGGTTTGAGCTCAGCTGCTACTCACTGGCCCCCCAGATAAAG    c.420
 K   | G  N  D  Q  V  R  F  E  L  S  C  Y  S  L  A  P  Q  I  K      p.140

  | 07       .         .         .         .         .         .    g.27078
  | GTCATTGCTCCCTGGAGGATGCCTGAATTCTACAACCGGTTCAAGGGCCGCAATGACCTG    c.480
  | V  I  A  P  W  R  M  P  E  F  Y  N  R  F  K  G  R  N  D  L      p.160

          .      | 08  .         .         .         .         .    g.31172
 ATGGAGTACGCAAAG | CAACACGGGATTCCCATCCCGGTCACTCCCAAGAACCCGTGGAGC    c.540
 M  E  Y  A  K   | Q  H  G  I  P  I  P  V  T  P  K  N  P  W  S      p.180

          .         .       | 09 .         .         .        | 10. g.37167
 ATGGATGAGAACCTCATGCACATCAG | CTACGAGGCTGGAATCCTGGAGAACCCCAAG | AAC c.600
 M  D  E  N  L  M  H  I  S  |  Y  E  A  G  I  L  E  N  P  K   | N   p.200

          .         .         .         .         .         .       g.37227
 CAAGCGCCTCCAGGTCTCTACACGAAGACCCAGGACCCAGCCAAAGCCCCCAACACCCCT       c.660
 Q  A  P  P  G  L  Y  T  K  T  Q  D  P  A  K  A  P  N  T  P         p.220

          .         .         | 11         .         .         .    g.40041
 GACATTCTCGAGATCGAGTTCAAAAAAG | GGGTCCCTGTGAAGGTGACCAACGTCAAGGAT    c.720
 D  I  L  E  I  E  F  K  K  G |   V  P  V  K  V  T  N  V  K  D      p.240

          .         .         .         .         .    | 12    .    g.40685
 GGCACCACCCACCAGACCTCCTTGGAGCTCTTCATGTACCTGAACGAAGTCGC | GGGCAAG    c.780
 G  T  T  H  Q  T  S  L  E  L  F  M  Y  L  N  E  V  A  |  G  K      p.260

          .         .         .         .         .         | 13    g.49628
 CATGGCGTGGGCCGTATTGACATCGTGGAGAACCGCTTCATTGGAATGAAGTCCCGAG | GT    c.840
 H  G  V  G  R  I  D  I  V  E  N  R  F  I  G  M  K  S  R  G |       p.280

          .         .         .         .         .         .       g.49688
 ATCTACGAGACCCCAGCAGGCACCATCCTTTACCATGCTCATTTAGACATCGAGGCCTTC       c.900
 I  Y  E  T  P  A  G  T  I  L  Y  H  A  H  L  D  I  E  A  F         p.300

          .         .         .         .         .         .       g.49748
 ACCATGGACCGGGAAGTGCGCAAAATCAAACAAGGCCTGGGCTTGAAATTTGCTGAGCTG       c.960
 T  M  D  R  E  V  R  K  I  K  Q  G  L  G  L  K  F  A  E  L         p.320

          . | 14       .         .         .         .         .    g.55210
 GTGTATACCG | GTTTCTGGCACAGCCCTGAGTGTGAATTTGTCCGCCACTGCATCGCCAAG    c.1020
 V  Y  T  G |   F  W  H  S  P  E  C  E  F  V  R  H  C  I  A  K      p.340

          .         .         .         .         .         .       g.55270
 TCCCAGGAGCGAGTGGAAGGGAAAGTGCAGGTGTCCGTCCTCAAGGGCCAGGTGTACATC       c.1080
 S  Q  E  R  V  E  G  K  V  Q  V  S  V  L  K  G  Q  V  Y  I         p.360

          .         .         .         .        | 15.         .    g.59811
 CTCGGCCGGGAGTCCCCACTGTCTCTCTACAATGAGGAGCTGGTGAG | CATGAACGTGCAG    c.1140
 L  G  R  E  S  P  L  S  L  Y  N  E  E  L  V  S  |  M  N  V  Q      p.380

          .         .         .         .         .    | 16    .    g.61276
 GGTGATTATGAGCCAACTGATGCCACCGGGTTCATCAACATCAATTCCCTCAG | GCTGAAG    c.1200
 G  D  Y  E  P  T  D  A  T  G  F  I  N  I  N  S  L  R  |  L  K      p.400

          .         .         .                                     g.61315
 GAATATCATCGTCTCCAGAGCAAGGTCACTGCCAAATAG                            c.1239
 E  Y  H  R  L  Q  S  K  V  T  A  K  X                              p.412

          .         .         .         .         .         .       g.61375
 acccgtgtacaatgaggagctggggcctcctcaatttgcagatcccccaagtacaggcgc       c.*60

          .         .         .         .         .         .       g.61435
 taattgttgtgataatttgtaattgtgacttgttctccccggctggcagcgtagtggggc       c.*120

          .         .         .         .         .         .       g.61495
 tgccaggccccagctttgttccctggtccccctgaagcctgcaaacgttgtcatcgaagg       c.*180

          .         .         .         .         .         .       g.61555
 gaagggtggggggcagctgcggtggggagctataaaaatgacaattaaaagagacactag       c.*240

          .                                                         g.61568
 tcttttatttcta                                                      c.*253

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Argininosuccinate synthase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19a
©2004-2017 Leiden University Medical Center