autophagy related 10 (ATG10) - coding DNA reference sequence

(used for variant description)

(last modified June 15, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_001131028.1 in the ATG10 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000005.9, covering ATG10 transcript NM_001131028.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5009
                                                    agtgcgcac       c.-421

 .         .         .         .         .         .                g.5069
 gctccgactcggccgtggcggacctgactgaaggaggccgcggacctgactgaaggaggc       c.-361

 .         .         .         .         .         .                g.5129
 cacggccacttctggttggcctcggggcgcgctggctcggctcttcctccgccctcgagg       c.-301

 .         .         .         .         .         .                g.5189
 cccccgcagtcccatcattcagttccgtagggtcaccggcgcggcagtggcctcgcaggg       c.-241

 .         .         .         .         .         .                g.5249
 cgctgggtccctctccccagctctcctccccctggccccgtcgccccgccctcgccgggc       c.-181

 .         .         .         .   | 02     .         .             g.9195
 tgggctgcggggtcaggggccgagcggagaggg | tagagacggggtttcaccgtgttagcc    c.-121

 .         .         .         .         .         .                g.9255
 aagatggtctcgatctcctgacctcgtgatccgcccgcctcggcctcccaaagtgctggg       c.-61

 .         .         .         .         .        | 03.             g.20546
 attacaggcgtgagccactgcgcccggcctgttgtacagttattaaag | ttatcatttaac    c.-1

          .         .         .         .         .         .       g.20606
 ATGGAAGAAGATGAGTTCATTGGAGAAAAAACATTCCAACGTTATTGTGCAGAATTCATT       c.60
 M  E  E  D  E  F  I  G  E  K  T  F  Q  R  Y  C  A  E  F  I         p.20

          .         .         .         .         | 04         .    g.91482
 AAACATTCACAACAGATAGGTGATAGTTGGGAATGGAGACCATCAAAG | GACTGTTCTGAT    c.120
 K  H  S  Q  Q  I  G  D  S  W  E  W  R  P  S  K   | D  C  S  D      p.40

          .         .         .         .         .         .       g.91542
 GGCTACATGTGCAAAATACACTTTCAAATTAAGAATGGGTCTGTGATGTCACATCTAGGA       c.180
 G  Y  M  C  K  I  H  F  Q  I  K  N  G  S  V  M  S  H  L  G         p.60

          .         .         .       | 05 .         .         .    g.197398
 GCATCTACCCATGGACAGACATGTCTTCCCATGGAG | GAGGCTTTCGAGCTACCCTTGGAT    c.240
 A  S  T  H  G  Q  T  C  L  P  M  E   | E  A  F  E  L  P  L  D      p.80

          .         .         .         .         .         .       g.197458
 GATTGTGAAGTGATTGAAACTGCAGCAGCGTCCGAAGTGATTAAATATGAGTATCATGTC       c.300
 D  C  E  V  I  E  T  A  A  A  S  E  V  I  K  Y  E  Y  H  V         p.100

          .         .         .         .         .      | 06  .    g.211470
 TTATATTCCTGTAGCTACCAAGTGCCTGTACTTTACTTTAGGGCAAGCTTTTTAG | ATGGG    c.360
 L  Y  S  C  S  Y  Q  V  P  V  L  Y  F  R  A  S  F  L  D |   G      p.120

          .         .         .         .         .         .       g.211530
 AGACCTTTAACTCTGAAGGACATATGGGAAGGAGTTCATGAGTGCTATAAGATGCGACTG       c.420
 R  P  L  T  L  K  D  I  W  E  G  V  H  E  C  Y  K  M  R  L         p.140

          .         .         .    | 07    .         .         .    g.285564
 CTACAGGGACCATGGGACACTATTACGCAACAG | GAACATCCAATACTTGGGCAACCCTTT    c.480
 L  Q  G  P  W  D  T  I  T  Q  Q   | E  H  P  I  L  G  Q  P  F      p.160

          .         .         .         .         .         .       g.285624
 TTTGTACTTCATCCCTGCAAGACGAATGAATTCATGACTCCTGTATTAAAGAATTCTCAG       c.540
 F  V  L  H  P  C  K  T  N  E  F  M  T  P  V  L  K  N  S  Q         p.180

          .  | 08      .         .         .         .         .    g.286338
 AAAATCAATAA | GAATGTCAACTATATCACATCATGGCTGAGCATTGTAGGGCCAGTTGTT    c.600
 K  I  N  K  |  N  V  N  Y  I  T  S  W  L  S  I  V  G  P  V  V      p.200

          .         .         .         .         .         .       g.286398
 GGGCTGAATCTACCTCTGAGTTATGCCAAAGCAACGTCTCAGGATGAACGAAATGTCCCT       c.660
 G  L  N  L  P  L  S  Y  A  K  A  T  S  Q  D  E  R  N  V  P         p.220

                                                                g.286401
 TAA |                                                             c.664
 X                                                               p.220

      | 09   .         .         .         .         .         .    g.287099
 caag | attcttctattgagtttaggaattgcggcacgaagaatgccaagagtttacctggc    c.*60

          .         .         .         .         .         .       g.287159
 cagccctggctttaataggactgataccatggaatatttcatctcaccaagatgtgacat       c.*120

          .         .         .         .         .         .       g.287219
 ggattatttttcccttggacacaaatgtctacagcaactggtgtttgataggctgaatgt       c.*180

          .         .         .         .         .         .       g.287279
 ttagaagaaacacttcaaagggatacatcatggccaggcatggtggctcacacctgtaat       c.*240

          .         .         .         .         .         .       g.287339
 ccaagcactttgggaggccaaggtgggagcatcacttgatcctgggagttcgagaccagc       c.*300

          .         .         .         .         .         .       g.287399
 ctgggcaacatggtgaaaccctgtcggtacaaaaaaatacaaaaatttgcctgtttatgg       c.*360

          .         .         .         .         .         .       g.287459
 tggtgtgttcctgtagtcccagctccccaggaggctgaggtgggaggttggctttaaccc       c.*420

          .         .         .         .         .         .       g.287519
 aggaggcagaggttgcagtgagctgagactgtgccactgcagtccagcctgggtgacaga       c.*480

          .         .         .         .         .         .       g.287579
 gccagacactgtctcggggaaaaaaaaaaaaaaaaaaagacacatcactataaatagcaa       c.*540

          .         .         .         .         .         .       g.287639
 aaaaacaaatctaacttattaatactaggaataccaacattattagggcacttgcaggtt       c.*600

          .         .         .         .         .         .       g.287699
 attcttttctaggccaagtacttcacttccatttgtctgacatggagattgagggagaaa       c.*660

          .         .         .         .         .         .       g.287759
 tgtatttgtgtgttcattttaatgtaagatatataaaaattaaattactggatttacctg       c.*720

          .         .         .         .         .         .       g.287819
 tccctgaaactggtgttataaacatgacctatcttaagtgattttcccacaatcaaactc       c.*780

          .         .         .         .         .         .       g.287879
 aggaacaatagattatttctgttttactccaaaagagagagagagagtgagtgtgagtgt       c.*840

          .         .         .         .         .         .       g.287939
 gtgtgtgtgtgtgtgtgtatgtgtgggtgtttgtgtagatagttgtaaaacaaagaaaaa       c.*900

          .         .         .         .         .         .       g.287999
 acacaatattttactgtgagataatatgttttaccagcaaagtgtggcatagtaattaga       c.*960

          .         .         .         .         .         .       g.288059
 agttttctaaaaagctataggagatatttaaacattaaaatttctttttgacctatagta       c.*1020

          .         .         .         .         .         .       g.288119
 ataaaacaatggtcattttacccctctgcttctcaaccccacagctgctctgctgtactc       c.*1080

          .         .         .         .         .         .       g.288179
 tttgagggctcttgagcgagtcttcatgtccctgagacttattttcctcatctttaattt       c.*1140

          .         .         .         .         .         .       g.288239
 gaaactaacaagctacctcatagggttgctgtgagaaccacatgagatcattaatgcatg       c.*1200

          .         .         .         .         .         .       g.288299
 ataagatattgtaaagtattatacgaatattcattaaatgctcacctttcttgtatataa       c.*1260

          .         .         .         .         .         .       g.288359
 ttggtattcactaaggctgtaaataagtttcatagccagttaagtattaagataaaccta       c.*1320

          .                                                         g.288370
 acctggaacaa                                                        c.*1331

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Autophagy related 10 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center