ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit (ATP5D) - coding DNA reference sequence

(used for variant description)

(last modified March 24, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_001687.4 in the ATP5D gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering ATP5D transcript NM_001687.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5041
                    cagacgtccctgcgcgtcgtcctcctcgccctccaggccgc       c.-61

 .         .         .         .         .         .                g.5101
 ccgcgccgcgccggagtccgctgtccgccagctacccgcttcctgccgcccgccgctgcc       c.-1

          .         .         .         .         .         .       g.5161
 ATGCTGCCCGCCGCGCTGCTCCGCCGCCCGGGACTTGGCCGCCTCGTCCGCCACGCCCGT       c.60
 M  L  P  A  A  L  L  R  R  P  G  L  G  R  L  V  R  H  A  R         p.20

          .         .         .         .         .         .       g.5221
 GCCTATGCCGAGGCCGCCGCCGCCCCGGCTGCCGCCTCTGGCCCCAACCAGATGTCCTTC       c.120
 A  Y  A  E  A  A  A  A  P  A  A  A  S  G  P  N  Q  M  S  F         p.40

          .         .  | 02      .         .         .         .    g.5745
 ACCTTCGCCTCTCCCACGCAG | GTGTTCTTCAACGGTGCCAACGTCCGGCAGGTGGACGTG    c.180
 T  F  A  S  P  T  Q   | V  F  F  N  G  A  N  V  R  Q  V  D  V      p.60

          .         .         .         .         .         .       g.5805
 CCCACGCTGACCGGAGCCTTCGGCATCCTGGCGGCCCACGTGCCCACGCTGCAGGTCCTG       c.240
 P  T  L  T  G  A  F  G  I  L  A  A  H  V  P  T  L  Q  V  L         p.80

          .         .         .         .         .      | 03  .    g.7352
 CGGCCGGGGCTGGTCGTGGTGCATGCAGAGGACGGCACCACCTCCAAATACTTTG | TGAGC    c.300
 R  P  G  L  V  V  V  H  A  E  D  G  T  T  S  K  Y  F  V |   S      p.100

          .         .         .         .         .         .       g.7412
 AGCGGTTCCATCGCAGTGAACGCCGACTCTTCGGTGCAGTTGTTGGCCGAAGAGGCCGTG       c.360
 S  G  S  I  A  V  N  A  D  S  S  V  Q  L  L  A  E  E  A  V         p.120

          .         .     | 04   .         .         .         .    g.7601
 ACGCTGGACATGTTGGACCTGGGG | GCAGCCAAGGCAAACTTGGAGAAGGCCCAGGCGGAG    c.420
 T  L  D  M  L  D  L  G   | A  A  K  A  N  L  E  K  A  Q  A  E      p.140

          .         .         .         .         .         .       g.7661
 CTGGTGGGGACAGCTGACGAGGCCACGCGGGCAGAGATCCAGATCCGAATCGAGGCCAAC       c.480
 L  V  G  T  A  D  E  A  T  R  A  E  I  Q  I  R  I  E  A  N         p.160

          .         .                                               g.7688
 GAGGCCCTGGTGAAGGCCCTGGAGTAG                                        c.507
 E  A  L  V  K  A  L  E  X                                          p.168

          .         .         .         .         .         .       g.7748
 gcggtgcgtacccggtgtcccgaggcccggccaggggctgggcagggatgccaggtgggc       c.*60

          .         .         .         .         .         .       g.7808
 ccagccagctcctggggtcccggccacctggggaagccgcgcctgccaaggaggccacca       c.*120

          .         .         .         .         .         .       g.7868
 gagggcagtgcaggcttctgcctgggccccaggccctgcctgtgttgaaagctctgggga       c.*180

          .         .         .         .         .         .       g.7928
 ctgggccagggaagctcctcctcagctttgagctgtggctgccacccatggggctctcct       c.*240

          .         .         .         .         .         .       g.7988
 tccgcctctcaagatccccccagcctgacgggccgcttaccatcccctctgccctgcaga       c.*300

          .         .         .         .         .         .       g.8048
 gccagccgccaaggttgacctcagcttcggagccacctctggatgaactgcccccagccc       c.*360

          .         .                                               g.8076
 ccgccccattaaagacccggaagcctga                                       c.*388

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.