ATPase, H+ transporting, lysosomal accessory protein 2 (ATP6AP2) - coding DNA reference sequence

(used for variant description)

(last modified November 8, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_005765.2 in the ATP6AP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008874.1, covering ATP6AP2 transcript NM_005765.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5042
                   ctggacgagtccgagcgcgtcacctcctcacgctgcggctgt       c.-61

 .         .         .         .         .         .                g.5102
 cgcccgtgtcccgccggcccgttccgtgtcgccccgcagtgctgcggccgccgcggcacc       c.-1

          .         .         .        | 02.         .         .    g.13045
 ATGGCTGTGTTTGTCGTGCTCCTGGCGTTGGTGGCGG | GTGTTTTGGGGAACGAGTTTAGT    c.60
 M  A  V  F  V  V  L  L  A  L  V  A  G |   V  L  G  N  E  F  S      p.20

          .         .         .         .         .         .       g.13105
 ATATTAAAATCACCAGGGTCTGTTGTTTTCCGAAATGGAAATTGGCCTATACCAGGAGAG       c.120
 I  L  K  S  P  G  S  V  V  F  R  N  G  N  W  P  I  P  G  E         p.40

          .         .         .         .         | 03         .    g.15282
 CGGATCCCAGACGTGGCTGCATTGTCCATGGGCTTCTCTGTGAAAGAA | GACCTTTCTTGG    c.180
 R  I  P  D  V  A  A  L  S  M  G  F  S  V  K  E   | D  L  S  W      p.60

          .         .         .         .         .         .       g.15342
 CCAGGACTCGCAGTGGGTAACCTGTTTCATCGTCCTCGGGCTACCGTCATGGTGATGGTG       c.240
 P  G  L  A  V  G  N  L  F  H  R  P  R  A  T  V  M  V  M  V         p.80

          .         .         .         .         .         .       g.15402
 AAGGGAGTGAACAAACTGGCTCTACCCCCAGGCAGTGTCATTTCGTACCCTTTGGAGAAT       c.300
 K  G  V  N  K  L  A  L  P  P  G  S  V  I  S  Y  P  L  E  N         p.100

  | 04       .         .         .         .         .         .    g.21345
  | GCAGTTCCTTTTAGTCTTGACAGTGTTGCAAATTCCATTCACTCCTTATTTTCTGAGGAA    c.360
  | A  V  P  F  S  L  D  S  V  A  N  S  I  H  S  L  F  S  E  E      p.120

          .         .         .       | 05 .         .         .    g.21587
 ACTCCTGTTGTTTTGCAGTTGGCTCCCAGTGAGGAA | AGAGTGTATATGGTAGGGAAGGCA    c.420
 T  P  V  V  L  Q  L  A  P  S  E  E   | R  V  Y  M  V  G  K  A      p.140

          .         .         .         .         .         .       g.21647
 AACTCAGTGTTTGAAGACCTTTCAGTCACCTTGCGCCAGCTCCGTAATCGCCTGTTTCAA       c.480
 N  S  V  F  E  D  L  S  V  T  L  R  Q  L  R  N  R  L  F  Q         p.160

          .         .         .         .         .     | 06   .    g.22723
 GAAAACTCTGTTCTCAGTTCACTCCCCCTCAATTCTCTGAGTAGGAACAATGAA | GTTGAC    c.540
 E  N  S  V  L  S  S  L  P  L  N  S  L  S  R  N  N  E   | V  D      p.180

          .         .         .         .         | 07         .    g.23640
 CTGCTCTTTCTTTCTGAACTGCAAGTGCTACATGATATTTCAAGCTTG | CTGTCTCGTCAT    c.600
 L  L  F  L  S  E  L  Q  V  L  H  D  I  S  S  L   | L  S  R  H      p.200

          .         .         .         .         .         .       g.23700
 AAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGAT       c.660
 K  H  L  A  K  D  H  S  P  D  L  Y  S  L  E  L  A  G  L  D         p.220

          .         .         .         .         .         .       g.23760
 GAAATTGGGAAGCGTTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTT       c.720
 E  I  G  K  R  Y  G  E  D  S  E  Q  F  R  D  A  S  K  I  L         p.240

          .         | 08         .         .         .         .    g.24840
 GTTGACGCTCTGCAAAAG | TTTGCAGATGACATGTACAGTCTTTATGGTGGGAATGCAGTG    c.780
 V  D  A  L  Q  K   | F  A  D  D  M  Y  S  L  Y  G  G  N  A  V      p.260

          .         .         .         .         .         .       g.24900
 GTAGAGTTAGTCACTGTCAAGTCATTTGACACCTCCCTCATTAGGAAGACAAGGACTATC       c.840
 V  E  L  V  T  V  K  S  F  D  T  S  L  I  R  K  T  R  T  I         p.280

          .         | 09         .         .         .         .    g.29639
 CTTGAGGCAAAACAAGCG | AAGAACCCAGCAAGTCCCTATAACCTTGCATATAAGTATAAT    c.900
 L  E  A  K  Q  A   | K  N  P  A  S  P  Y  N  L  A  Y  K  Y  N      p.300

          .         .         .         .         .         .       g.29699
 TTTGAATATTCCGTGGTTTTCAACATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCT       c.960
 F  E  Y  S  V  V  F  N  M  V  L  W  I  M  I  A  L  A  L  A         p.320

          .         .         .         .         .         .       g.29759
 GTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGATATGATAGCATCATTTAT       c.1020
 V  I  I  T  S  Y  N  I  W  N  M  D  P  G  Y  D  S  I  I  Y         p.340

          .         .         .                                     g.29792
 AGGATGACAAACCAGAAGATTCGAATGGATTGA                                  c.1053
 R  M  T  N  Q  K  I  R  M  D  X                                    p.350

          .         .         .         .         .         .       g.29852
 atgttacctgtgccagaattagaaaagggggttggaaattggctgttttgttaaaatata       c.*60

          .         .         .         .         .         .       g.29912
 tcttttagtgtgctttaaagtagatagtatactttacatttataaaaaaaaatcaaattt       c.*120

          .         .         .         .         .         .       g.29972
 tgttctttattttgtgtgtgcctgtgatgtttttctagagtgaattatagtattgacgtg       c.*180

          .         .         .         .         .         .       g.30032
 aatcccactgtggtatagattccataatatgcttgaatattatgatatagccatttaata       c.*240

          .         .         .         .         .         .       g.30092
 acattgatttcattctgtttaatgaatttggaaatatgcactgaaagaaatgtaaaacat       c.*300

          .         .         .         .         .         .       g.30152
 ttagaatagctcgtgttatggaaaaaagtgcactgaatttattagacaaacttacgaatg       c.*360

          .         .         .         .         .         .       g.30212
 cttaacttctttacacagcataggtgaaaatcatatttgggctattgtatactatgaaca       c.*420

          .         .         .         .         .         .       g.30272
 atttgtaaatgtcttaatttgatgtaaataactctgaaacaagagaaaaggtttttaact       c.*480

          .         .         .         .         .         .       g.30332
 tagagtagccctaaaatatggatgtgcttatataatcgcttagttttggaactgtatctg       c.*540

          .         .         .         .         .         .       g.30392
 agtaacagaggacagctgttttttaaccctcttctgcaagtttgttgacctacatgggct       c.*600

          .         .         .         .         .         .       g.30452
 aatatggatactaaaaatactacattgatctaagaagaaactagccttgtggagtatata       c.*660

          .         .         .         .         .         .       g.30512
 gatgcttttcattatacacacaaaaatccctgagggacattttgaggcatgaatataaaa       c.*720

          .         .         .         .         .         .       g.30572
 catttttatttcagtaacttttccccctgtgtaagttactatggtttgtggtacaacttc       c.*780

          .         .         .         .         .         .       g.30632
 attctatagaatattaagtggaagtgggtgaattctactttttatgttggagtggaccaa       c.*840

          .         .         .         .                           g.30674
 tgtctatcaagagtgacaaataaagttaatgatgattccaaa                         c.*882

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The ATPase, H+ transporting, lysosomal accessory protein 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 20a
©2004-2017 Leiden University Medical Center