arginine vasopressin (AVP) - coding DNA reference sequence

(used for variant description)

(last modified August 31, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_000490.4 in the AVP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008663.1, covering AVP transcript NM_000490.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5050
           acagagccaccaagcagtgctgcatacggggtccacctgtgtgcaccagg       c.-1

          .         .         .         .         .         .       g.5110
 ATGCCTGACACCATGCTGCCCGCCTGCTTCCTCGGCCTACTGGCCTTCTCCTCCGCGTGC       c.60
 M  P  D  T  M  L  P  A  C  F  L  G  L  L  A  F  S  S  A  C         p.20

          .         .         .         .         .         .       g.5170
 TACTTCCAGAACTGCCCGAGGGGCGGCAAGAGGGCCATGTCCGACCTGGAGCTGAGACAG       c.120
 Y  F  Q  N  C  P  R  G  G  K  R  A  M  S  D  L  E  L  R  Q         p.40

  | 02       .         .         .         .         .         .    g.6606
  | TGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGCTGCTTCGGGCCCAGCATCTGCTGCGCG    c.180
  | C  L  P  C  G  P  G  G  K  G  R  C  F  G  P  S  I  C  C  A      p.60

          .         .         .         .         .         .       g.6666
 GACGAGCTGGGCTGCTTCGTGGGCACGGCTGAGGCGCTGCGCTGCCAGGAGGAGAACTAC       c.240
 D  E  L  G  C  F  V  G  T  A  E  A  L  R  C  Q  E  E  N  Y         p.80

          .         .         .         .         .         .       g.6726
 CTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCGTGCGGGAGCGGGGGCCGCTGCGCCGCC       c.300
 L  P  S  P  C  Q  S  G  Q  K  A  C  G  S  G  G  R  C  A  A         p.100

          .         .   | 03     .         .         .         .    g.6960
 TTCGGCGTTTGCTGCAACGACG | AGAGCTGCGTGACCGAGCCCGAGTGCCGCGAGGGCTTT    c.360
 F  G  V  C  C  N  D  E |   S  C  V  T  E  P  E  C  R  E  G  F      p.120

          .         .         .         .         .         .       g.7020
 CACCGCCGCGCCCGCGCCAGCGACCGGAGCAACGCCACGCAGCTGGACGGGCCGGCCGGG       c.420
 H  R  R  A  R  A  S  D  R  S  N  A  T  Q  L  D  G  P  A  G         p.140

          .         .         .         .         .         .       g.7080
 GCCTTGCTGCTGCGGCTGGTGCAGCTGGCCGGGGCGCCCGAGCCCTTCGAGCCCGCCCAG       c.480
 A  L  L  L  R  L  V  Q  L  A  G  A  P  E  P  F  E  P  A  Q         p.160

          .                                                         g.7095
 CCCGACGCCTACTGA                                                    c.495
 P  D  A  Y  X                                                      p.164

          .         .         .         .         .         .       g.7155
 gccccgcgctcgccccaccggcgcgctcttcgcgcccgcccctgcagcacggacaataaa       c.*60

          .                                                         g.7169
 cctccgccaatgca                                                     c.*74

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Arginine vasopressin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.