beta-2-microglobulin (B2M) - coding DNA reference sequence

(used for variant description)

(last modified September 24, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_004048.2 in the B2M gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012920.1, covering B2M transcript NM_004048.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
 .         .         .         .         .         .                g.5060
 aatataagtggaggcgtcgcgctggcgggcattcctgaagctgacagcattcgggccgag       c.-1

          .         .         .         .         .         .       g.5120
 ATGTCTCGCTCCGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTCTGGCCTGGAGGCT       c.60
 M  S  R  S  V  A  L  A  V  L  A  L  L  S  L  S  G  L  E  A         p.20

         | 02.         .         .         .         .         .    g.8989
 ATCCAGC | GTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCA    c.120
 I  Q  R |   T  P  K  I  Q  V  Y  S  R  H  P  A  E  N  G  K  S      p.40

          .         .         .         .         .         .       g.9049
 AATTTCCTGAATTGCTATGTGTCTGGGTTTCATCCATCCGACATTGAAGTTGACTTACTG       c.180
 N  F  L  N  C  Y  V  S  G  F  H  P  S  D  I  E  V  D  L  L         p.60

          .         .         .         .         .         .       g.9109
 AAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGG       c.240
 K  N  G  E  R  I  E  K  V  E  H  S  D  L  S  F  S  K  D  W         p.80

          .         .         .         .         .         .       g.9169
 TCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGC       c.300
 S  F  Y  L  L  Y  Y  T  E  F  T  P  T  E  K  D  E  Y  A  C         p.100

          .         .         .         .       | 03 .         .    g.9856
 CGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGG | ATCGAGACATGTAA    c.360
 R  V  N  H  V  T  L  S  Q  P  K  I  V  K  W  D |   R  D  M  X      p.119

          .     | 04   .         .         .         .         .    g.11166
 gcagcatcatggag | gtttgaagatgccgcatttggattggatgaattccaaattctgctt    c.*60

          .         .         .         .         .         .       g.11226
 gcttgctttttaatattgatatgcttatacacttacactttatgcacaaaatgtagggtt       c.*120

          .         .         .         .         .         .       g.11286
 ataataatgttaacatggacatgatcttctttataattctactttgagtgctgtctccat       c.*180

          .         .         .         .         .         .       g.11346
 gtttgatgtatctgagcaggttgctccacaggtagctctaggagggctggcaacttagag       c.*240

          .         .         .         .         .         .       g.11406
 gtggggagcagagaattctcttatccaacatcaacatcttggtcagatttgaactcttca       c.*300

          .         .         .         .         .         .       g.11466
 atctcttgcactcaaagcttgttaagatagttaagcgtgcataagttaacttccaattta       c.*360

          .         .         .         .         .         .       g.11526
 catactctgcttagaatttgggggaaaatttagaaatataattgacaggattattggaaa       c.*420

          .         .         .         .         .         .       g.11586
 tttgttataatgaatgaaacattttgtcatataagattcatatttacttcttatacattt       c.*480

          .         .         .         .         .         .       g.11646
 gataaagtaaggcatggttgtggttaatctggtttatttttgttccacaagttaaataaa       c.*540

          .         .                                               g.11673
 tcataaaacttgatgtgttatctctta                                        c.*567

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Beta-2-microglobulin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.