UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 (B3GALT6) - coding DNA reference sequence

(used for variant description)

(last modified October 21, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_080605.3 in the B3GALT6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering B3GALT6 transcript NM_080605.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5030
                               ggcctgggccgccggcccggcgcgggcgcc       c.-1

          .         .         .         .         .         .       g.5090
 ATGAAGCTGCTGCGGCGGGCGTGGCGGCGGCGGGCGGCGCTAGGCCTGGGCACGCTGGCG       c.60
 M  K  L  L  R  R  A  W  R  R  R  A  A  L  G  L  G  T  L  A         p.20

          .         .         .         .         .         .       g.5150
 CTGTGCGGGGCGGCGCTGCTCTACCTGGCGCGCTGCGCGGCCGAGCCCGGGGACCCCAGG       c.120
 L  C  G  A  A  L  L  Y  L  A  R  C  A  A  E  P  G  D  P  R         p.40

          .         .         .         .         .         .       g.5210
 GCGATGTCGGGCCGCAGCCCGCCTCCCCCCGCGCCCGCGCGCGCCGCCGCCTTCCTGGCA       c.180
 A  M  S  G  R  S  P  P  P  P  A  P  A  R  A  A  A  F  L  A         p.60

          .         .         .         .         .         .       g.5270
 GTGCTGGTGGCCAGCGCGCCCCGCGCCGCCGAGCGCCGCAGCGTGATCCGCAGCACGTGG       c.240
 V  L  V  A  S  A  P  R  A  A  E  R  R  S  V  I  R  S  T  W         p.80

          .         .         .         .         .         .       g.5330
 CTTGCGCGGCGCGGGGCCCCGGGCGACGTGTGGGCGCGCTTTGCCGTGGGCACGGCCGGC       c.300
 L  A  R  R  G  A  P  G  D  V  W  A  R  F  A  V  G  T  A  G         p.100

          .         .         .         .         .         .       g.5390
 CTGGGCGCCGAGGAGCGGCGCGCCCTGGAGCGGGAGCAGGCGCGGCACGGGGACCTGCTG       c.360
 L  G  A  E  E  R  R  A  L  E  R  E  Q  A  R  H  G  D  L  L         p.120

          .         .         .         .         .         .       g.5450
 CTGCTGCCCGCGCTGCGCGACGCCTACGAAAACCTCACGGCCAAGGTGCTGGCCATGCTG       c.420
 L  L  P  A  L  R  D  A  Y  E  N  L  T  A  K  V  L  A  M  L         p.140

          .         .         .         .         .         .       g.5510
 GCCTGGCTGGACGAGCACGTGGCCTTCGAGTTCGTGCTCAAGGCGGACGACGACTCCTTC       c.480
 A  W  L  D  E  H  V  A  F  E  F  V  L  K  A  D  D  D  S  F         p.160

          .         .         .         .         .         .       g.5570
 GCGCGGCTGGACGCGCTGCTGGCCGAGCTGCGCGCCCGCGAGCCCGCGCGCCGCCGCCGC       c.540
 A  R  L  D  A  L  L  A  E  L  R  A  R  E  P  A  R  R  R  R         p.180

          .         .         .         .         .         .       g.5630
 CTCTACTGGGGCTTCTTCTCGGGCCGCGGCCGCGTCAAGCCGGGGGGGCGCTGGCGCGAG       c.600
 L  Y  W  G  F  F  S  G  R  G  R  V  K  P  G  G  R  W  R  E         p.200

          .         .         .         .         .         .       g.5690
 GCCGCCTGGCAACTCTGCGACTACTACCTGCCCTACGCGCTGGGCGGCGGCTACGTGCTC       c.660
 A  A  W  Q  L  C  D  Y  Y  L  P  Y  A  L  G  G  G  Y  V  L         p.220

          .         .         .         .         .         .       g.5750
 TCGGCCGACCTGGTGCACTACCTGCGCCTCAGCCGCGACTACCTGCGCGCCTGGCACAGC       c.720
 S  A  D  L  V  H  Y  L  R  L  S  R  D  Y  L  R  A  W  H  S         p.240

          .         .         .         .         .         .       g.5810
 GAGGACGTGTCTCTGGGCGCCTGGCTGGCGCCGGTGGACGTCCAGCGGGAGCACGACCCG       c.780
 E  D  V  S  L  G  A  W  L  A  P  V  D  V  Q  R  E  H  D  P         p.260

          .         .         .         .         .         .       g.5870
 CGCTTCGACACCGAATACCGGTCCCGCGGCTGCAGCAACCAGTACCTGGTGACGCACAAG       c.840
 R  F  D  T  E  Y  R  S  R  G  C  S  N  Q  Y  L  V  T  H  K         p.280

          .         .         .         .         .         .       g.5930
 CAGAGCCTGGAGGACATGCTGGAGAAGCACGCGACGCTGGCGCGCGAGGGCCGCCTGTGC       c.900
 Q  S  L  E  D  M  L  E  K  H  A  T  L  A  R  E  G  R  L  C         p.300

          .         .         .         .         .         .       g.5990
 AAGCGCGAGGTGCAGCTGCGCCTGTCCTACGTGTACGACTGGTCCGCGCCGCCCTCGCAG       c.960
 K  R  E  V  Q  L  R  L  S  Y  V  Y  D  W  S  A  P  P  S  Q         p.320

          .         .         .                                     g.6020
 TGCTGCCAGAGAAGGGAGGGCATCCCCTGA                                     c.990
 C  C  Q  R  R  E  G  I  P  X                                       p.329

          .         .         .         .         .         .       g.6080
 gccgccgcggcccggccctccgggacacctgcttcacccggcggcgccttggggcaggtg       c.*60

          .         .         .         .         .         .       g.6140
 ccgagcgggcgcactacgcccgggccccaaggcccccgtcccgcagccacgcttgtggtc       c.*120

          .         .         .         .         .         .       g.6200
 gctgcgtcccggtctgcgtttgggagacccctgggggttgccggggcagcgcgccgtgtc       c.*180

          .         .         .         .         .         .       g.6260
 caggtggaggtgcccgttcctggacctcagcgagcctgagccgggcccggccgcacgctg       c.*240

          .         .         .         .         .         .       g.6320
 acccccgtgctgtccccgaccggctcacggggctgggctccgatcttccgtgtctcttat       c.*300

          .         .         .         .         .         .       g.6380
 cagtggcgtttctcacgtctgcgtctcagatctaacgtggtttcacatcaatccgctttc       c.*360

          .         .         .         .         .         .       g.6440
 atgggattttggtctctgtccagtgacttcgtggtaaatgtaactcagtgtttgcttgcg       c.*420

          .         .         .         .         .         .       g.6500
 acttatttataaatattgtaagtttgtgtcgatgagtgtaagttggcagtgcgcacgtct       c.*480

          .         .         .         .         .         .       g.6560
 cggtttttttacatgatttaaggaaagacttttatgtcagaacttggtgcctgtaccgtc       c.*540

          .         .         .         .         .         .       g.6620
 aaccccgctgctgcccgtgtttaaacgcaggagaactttaaaactggccatctatctttt       c.*600

          .         .         .         .         .         .       g.6680
 cagtgtacaagtcactgaacccattgtttctttctgaagagactttcctttcaaggcttc       c.*660

          .         .         .         .         .         .       g.6740
 ccatgggtccgcgccacacagggccggtgctgctttatttcagactctgccccaggttcc       c.*720

          .         .         .         .         .         .       g.6800
 aggaatccgaaccccggagtgctgacgcggttccccaacttccgccttaagaaaacagga       c.*780

          .         .         .         .         .         .       g.6860
 ccagccggcaccaggcccgtctctcacgtactttaacacatccttgaaagcccctcgttt       c.*840

          .         .         .         .         .         .       g.6920
 aatgagaaaagcgaacactgcggtccttgccaaagtaaaatgaagctgccccaggacaag       c.*900

          .         .         .         .         .         .       g.6980
 gggttaccatgagctccctggagtccgacgcgggttttctctctgggggacctgggtggt       c.*960

          .         .         .         .         .         .       g.7040
 ccccgctgtggtctttgttgtcccactttgggaccgggtccagtctggggtctagtctcg       c.*1020

          .         .         .         .         .         .       g.7100
 agcatcagggtcaggctcggggcagggctgggttaggctccgggtcagtcttgccatggg       c.*1080

          .         .         .         .         .         .       g.7160
 tttgggagcaggtttgggttacttgcgtttgaaggcagcagtggtctcaggaggaagaaa       c.*1140

          .         .         .         .         .         .       g.7220
 cgggggcgggagagagtggtgatctgtggtcagtgggtcagtgacctgcacggtgattct       c.*1200

          .         .         .         .         .         .       g.7280
 cccacctccaaaaggtaggggtgggactggaggcgtccctaggtcaggccgttgagttcg       c.*1260

          .         .         .         .         .         .       g.7340
 agctccgatgggccaccttgaatccaggactgaccgcccgtgtgtgcacagtttgttctt       c.*1320

          .         .         .         .         .         .       g.7400
 ggacgaggactcgtgaggatcgagggctggggaccccggtgtgagcaggatggggccctg       c.*1380

          .         .         .         .         .         .       g.7460
 ccctcccgtgggagttgtggactcgagcccaggggctgcccgtcacagcggtgtcccagg       c.*1440

          .         .         .         .         .         .       g.7520
 tccctgccatccgattttacctgggatgtcttctctggagtttggaattgcttgaggaac       c.*1500

          .         .         .         .         .         .       g.7580
 cctgcgtgtgcttggagaggccagagggcttgctgagaaccccatggacagtggagagcg       c.*1560

          .         .         .         .         .         .       g.7640
 ggattcgaaccaagggctggactcccacacctctggcctgcgtcgcccagttctttgtgg       c.*1620

          .         .         .         .         .         .       g.7700
 ctctgaagaattggccgctgtggaaaagagcaaatgtccgagacccccaacaggaagagt       c.*1680

          .         .         .         .         .         .       g.7760
 ctaaaaatccagtttgcaaccacttctgacctacaaaaaaatggaaatttagtgtttttc       c.*1740

          .         .         .                                     g.7793
 agcctaagacattaaatttcatatcagaacaaa                                  c.*1773

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center