beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) (B3GAT3) - coding DNA reference sequence

(used for variant description)

(last modified March 3, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_012200.3 in the B3GAT3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering B3GAT3 transcript NM_012200.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5048
             gggaccggaaatcaagtctacaaggcgggggggtgcacagatgaccgg       c.-181

 .         .         .         .         .         .                g.5108
 aagcgtgccctggcggcgctgccagccccagctgggagctggtaggggagtgcgaggaag       c.-121

 .         .         .         .         .         .                g.5168
 gcgggacgcagggcggagccgctgcaggggcggggcctgcggacaggagccggggtttgg       c.-61

 .         .         .         .         .         .                g.5228
 ggcgggaacccctcgtcccctgcagaccccgcctgctcgggcgcgggcggcggcgcggcc       c.-1

          .         .         .         .         .         .       g.5288
 ATGAAGCTGAAGCTGAAGAACGTGTTTCTCGCCTACTTCCTGGTGTCGATCGCCGGCCTC       c.60
 M  K  L  K  L  K  N  V  F  L  A  Y  F  L  V  S  I  A  G  L         p.20

          .         .   | 02     .         .         .         .    g.6542
 CTCTACGCGCTGGTACAGCTCG | GCCAGCCATGTGACTGCCTTCCTCCCCTGCGGGCAGCA    c.120
 L  Y  A  L  V  Q  L  G |   Q  P  C  D  C  L  P  P  L  R  A  A      p.40

          .         .         .         .         .         .       g.6602
 GCCGAGCAGCTACGGCAGAAGGATCTGAGGATTTCCCAGCTGCAAGCGGAACTCCGACGG       c.180
 A  E  Q  L  R  Q  K  D  L  R  I  S  Q  L  Q  A  E  L  R  R         p.60

          .         .         .         .         .         .       g.6662
 CCACCCCCTGCCCCTGCCCAGCCCCCTGAACCCGAGGCCCTGCCTACTATCTATGTTGTT       c.240
 P  P  P  A  P  A  Q  P  P  E  P  E  A  L  P  T  I  Y  V  V         p.80

          .        | 03.         .         .         .         .    g.9871
 ACCCCCACCTATGCCAG | GCTGGTACAGAAGGCAGAGCTGGTACGACTGTCCCAGACACTG    c.300
 T  P  T  Y  A  R  |  L  V  Q  K  A  E  L  V  R  L  S  Q  T  L      p.100

          .         .         .         .         .         .       g.9931
 AGCCTGGTGCCCCGGCTGCATTGGCTGCTGGTGGAGGATGCTGAGGGTCCCACCCCGCTG       c.360
 S  L  V  P  R  L  H  W  L  L  V  E  D  A  E  G  P  T  P  L         p.120

          .         .         .         .         .         .       g.9991
 GTCTCAGGGCTGCTGGCTGCCTCTGGCCTCCTCTTCACACACCTGGTGGTCCTCACGCCC       c.420
 V  S  G  L  L  A  A  S  G  L  L  F  T  H  L  V  V  L  T  P         p.140

          .         .         .         .         .         .       g.10051
 AAAGCCCAGCGGCTTCGGGAGGGCGAGCCTGGCTGGGTTCATCCCCGTGGTGTCGAGCAG       c.480
 K  A  Q  R  L  R  E  G  E  P  G  W  V  H  P  R  G  V  E  Q         p.160

          .         .         .         .         .         .       g.10111
 CGGAACAAGGCCCTGGACTGGCTCCGGGGCAGAGGGGGTGCTGTGGGTGGGGAGAAGGAC       c.540
 R  N  K  A  L  D  W  L  R  G  R  G  G  A  V  G  G  E  K  D         p.180

          .         .         .         .         .         .       g.10171
 CCACCACCACCAGGGACCCAAGGAGTCGTCTACTTTGCTGACGATGACAACACCTACAGC       c.600
 P  P  P  P  G  T  Q  G  V  V  Y  F  A  D  D  D  N  T  Y  S         p.200

          .         | 04         .         .         .         .    g.10421
 CGGGAGCTGTTTGAGGAG | ATGCGCTGGACCCGTGGTGTCTCAGTGTGGCCTGTGGGGCTG    c.660
 R  E  L  F  E  E   | M  R  W  T  R  G  V  S  V  W  P  V  G  L      p.220

          .         .         .         .         .         .       g.10481
 GTGGGCGGCCTGCGATTCGAGGGCCCTCAGGTACAGGACGGCCGGGTAGTGGGCTTCCAC       c.720
 V  G  G  L  R  F  E  G  P  Q  V  Q  D  G  R  V  V  G  F  H         p.240

          .         .         .         .         .         .       g.10541
 ACAGCATGGGAGCCCAGCAGGCCCTTCCCTGTGGATATGGCTGGATTTGCCGTGGCCCTG       c.780
 T  A  W  E  P  S  R  P  F  P  V  D  M  A  G  F  A  V  A  L         p.260

          .         .         .         .         .         .       g.10601
 CCCTTGCTGTTAGATAAGCCCAATGCCCAATTTGATTCCACCGCTCCCCGGGGCCACCTG       c.840
 P  L  L  L  D  K  P  N  A  Q  F  D  S  T  A  P  R  G  H  L         p.280

          .         .         .         .         .         .       g.10661
 GAGAGCAGTCTTCTGAGCCACCTTGTGGATCCCAAGGACCTGGAGCCACGGGCTGCCAAC       c.900
 E  S  S  L  L  S  H  L  V  D  P  K  D  L  E  P  R  A  A  N         p.300

           | 05        .         .         .         .         .    g.11427
 TGCACTCGG | GTACTGGTGTGGCATACTCGGACAGAGAAGCCCAAGATGAAGCAGGAGGAG    c.960
 C  T  R   | V  L  V  W  H  T  R  T  E  K  P  K  M  K  Q  E  E      p.320

          .         .         .         .                           g.11475
 CAGCTGCAGCGGCAGGGCCGGGGCTCAGACCCAGCAATTGAGGTGTGA                   c.1008
 Q  L  Q  R  Q  G  R  G  S  D  P  A  I  E  V  X                     p.335

          .         .         .         .         .         .       g.11535
 tggcggccccaccccaactaccacctcttttcaggcacagaccttgtgggactgggcccc       c.*60

          .         .         .         .         .         .       g.11595
 aggcctgcccaggatgtggttttccaagtcctgacccttggagccagaagtggcccctct       c.*120

          .         .         .         .         .         .       g.11655
 gcccctccaggcccagggcatggtcctgctgcttcacccctcccctagcctgccgtgtgg       c.*180

          .         .         .         .         .         .       g.11715
 cactgcccacaggctggggacaagcagcccttgtgttgagtcaggttggccctgtctagg       c.*240

          .         .         .         .         .         .       g.11775
 gtggaacagaaggacagatggacccaggagggagggcagctgagtaactgggtaacttat       c.*300

          .         .         .         .         .         .       g.11835
 tggggctgggcatgcactggggggctggaggagctgggctggacccttcccacctgagca       c.*360

          .         .         .         .                           g.11880
 tgctgacccccttcctacctccagaataaagaatctcaacctgga                      c.*405

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 09
©2004-2014 Leiden University Medical Center