beta 3-glucosyltransferase (B3GLCT) - downstream reference sequence


         .         .            .         .         .         . g.137334
aaataaaaactttattatgtaatgaaaa / gttgaacactttcttacaaagaaaactctagg c.*2640

         .         .         .         .         .         .    g.137394
cccagatggtttcatcggtgatattctccaggcatccaaagatgaaatactatgtttatg    c.*2700

         .         .         .         .         .         .    g.137454
ggacataaactctttcagagcataatgaaaaaggaaacatttcccagctgaatttatgag    c.*2760

         .         .         .         .         .         .    g.137514
acccaagtttctctgacaccaaaacttgacaaaagaaaatcacagactaacaactttcat    c.*2820

         .         .         .         .         .         .    g.137574
gagcataaaagacagtgatcctaaacaaaatgatcagcaatatgtaaaaagaggatacat    c.*2880

         .         .         .         .         .         .    g.137634
aaaaaggatagtaactcatgaccaaatgggtttattccagggatgcaaggctactgtaac    c.*2940

         .         .         .         .         .         .    g.137694
attcaaaaatcaagtaattcaccacattaatagaataaaggagaaaaattgtataaccat    c.*3000

         .         .         .         .         .         .    g.137754
tttaatagctgcgcaaaaaaggaggaaaaaaagcatttgacagaattcagcagccaacct    c.*3060

         .         .         .         .         .         .    g.137814
tgtaattctcaaactaggtaaattcgtcaatataataaagagtatctacagaaaaaagta    c.*3120

         .         .         .         .         .         .    g.137874
tcataaatacctaatgctttcatattgaattatttctccccctaaatttggaggaaagac    c.*3180

         .         .         .         .         .         .    g.137934
tagaatgtttaccatcactacttctattcaacatcgtttaggagatcccagtcaggggaa    c.*3240

         .         .         .         .         .         .    g.137994
agaaaagaaaattatataaagagtaaatagaagtaaaaagatatttacagatgacttgat    c.*3300

         .         .         .         .         .         .    g.138054
tgcatacaaacagaatccaaagtattttataatgaatttagtaagatcactagatacagg    c.*3360

         .         .         .         .         .         .    g.138114
actgatataaaaaataattgtatttctacatactggcaacaaacaatttgaaaataaaat    c.*3420

         .         .         .         .         .         .    g.138174
tagggaaacaatgttatttacaatggtttacaaatattaaatactaaggaaatcgatctt    c.*3480

         .         .         .         .         .         .    g.138234
aaatgttaccaccactgccaaaaaaaaaaaaaaaaaaaaaaaaaaagcaggaatggatgg    c.*3540

         .         .         .         .         .         .    g.138294
atatgctaattggcttgattgtggcaatcattttacaatgtatacatatatacaatcatg    c.*3600

         .         .         .         .         .         .    g.138354
tacactaagtatatacactttttatgtgtcaagtatacctcagtaaagccggaaagcatt    c.*3660

         .         .         .         .         .         .    g.138414
agcaagcatctagaaatatctagaaataaatagttgcaagatctctgcactgaaaaccag    c.*3720

         .         .         .         .         .         .    g.138474
aaaatcttgagagatattaaaaaggaactaaggtttatcattttatgtactgaaatgttc    c.*3780

         .         .         .         .         .         .    g.138534
aatattgttatgactacaattatctcaaattgatctacagatttatttccagtaaaaatc    c.*3840

         .         .         .         .         .         .    g.138594
tgagactttgtgtgtaaaaattgacaaattggttcaaaatatagaaggaaatgcaaagga    c.*3900

         .         .         .         .         .         .    g.138654
ccgagaatagccaagccaattatgatgacaaaattcgaagatttacaagaacagatttca    c.*3960

         .         .         .         .         .         .    g.138714
agacctaccaaaaaactactcaagtgttttactggcatgacgattgaagttaggtaaatt    c.*4020

         .         .         .         .         .         .    g.138774
gagcagaatccatatataatatgattacttaatgtaagacaaaggtgatacatgcagttc    c.*4080

         .         .         .         .         .         .    g.138834
atgagggaaatgatcttttcaataaatgtagagaaattagatatatggaacaatatgaag    c.*4140

         .         .         .         .         .         .    g.138894
caactactaactcggattacagacattatattcaaagattaagctataaagcatctaaga    c.*4200

         .         .         .         .         .         .    g.138954
acagtacttttcaactgggggccttttagccctgggagacatttggcaagatttttgaat    c.*4260

         .         .         .         .         .         .    g.139014
gtcacaactggaagggggtgctactggcatctcatgggtaggccagagatgctgttaaac    c.*4320

         .         .         .         .         .         .    g.139074
accctacaatgcacaggagaagaattaacaaggaattatctagcctcaaattttagtatt    c.*4380

         .         .         .         .         .         .    g.139134
gtcaaggttgagaaacactagtctagaggaaaaccagactaaaatatcttcatgatctta    c.*4440

         .         .         .         .         .         .    g.139194
ggtaagcaatgaattattaaacaggtaataaaaagccactatctagggctagtgtggtgg    c.*4500

         .         .         .         .         .         .    g.139254
ctcacgtctgcagtctcaacattttggaaggctgaggcaggagaatttcttgaggctagg    c.*4560

         .         .         .         .                        g.139302
agttcgagaccagcttaggcaatgtaatgagaccctgactctacaaaa                c.*4608


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center