beta 3-glucosyltransferase (B3GLCT) - 7851 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.20186
gtactaatcccaatgatcaaatcttttcctcccttctaagattcatttgtattttctctg  c.120+60

         .         .         .         .         .         .  g.20246
ataggaatagtaatcatttcattcttcaattgttatttttattgttacataattcatata  c.120+120

         .         .         .         .         .         .  g.20306
atgtggtcaacatggattttgaatccctaatgcaacctataagatagacttgctttttac  c.120+180

         .         .         .         .         .         .  g.20366
aaatcctttaatatttaaggctgatccacttggttttaaagttattttgagaaaaaacgt  c.120+240

         .         .         .         .         .         .  g.20426
gttttgacatagagttggacattttaatagtcttgcttggataccatagttttccccagt  c.120+300

         .         .         .         .         .         .  g.20486
cttaccaaatacctttttttatttcttttttgcgacggagtttcactctgtcgcccaggc  c.120+360

         .         .         .         .         .         .  g.20546
tggagtgcagtggcacgatctcagatcactgcaacctctgcctcctgggttcaagcgatt  c.120+420

         .         .         .         .         .         .  g.20606
ctcctgtctcagcctccccagtagctgggaatacaggcatgcgccaccatgcccggctaa  c.120+480

         .         .         .         .         .         .  g.20666
tttttgcgtttttagtggagacggggtttcatcatgttgcccaggctgatctcaaattcc  c.120+540

         .         .         .         .         .         .  g.20726
tgacctcaagtgatccacccacctcagcctcccaaagtgctgggattacaggcatgagcc  c.120+600

         .         .         .         .         .         .  g.20786
accgcacccggcccagtcttaccaaatatcttaaccttgggtttaattttctcagtctat  c.120+660

         .         .         .         .         .         .  g.20846
gaaaggattttactatgtcacaggtgtcacagaaacctgattagtctctccttgaaggtg  c.120+720

         .         .         .         .         .         .  g.20906
gcaatgtgtgagagggcatgctggggcctgggcgggagacccaaaggtgactatgctacc  c.120+780

         .         .         .         .         .         .  g.20966
agagagtcagaaccagaaagctaggccaggggactcgcagagagcaggcagtacttatcc  c.120+840

         .         .         .         .         .         .  g.21026
caatctcagagctgctgcttttaaatcactggttgtagtcagggaatgtctctaaatgtt  c.120+900

         .         .         .         .         .         .  g.21086
tactagttgggctttgcactagatcagtttagcatgtaaaaaaggaaacagtagtttaaa  c.120+960

         .         .         .         .         .         .  g.21146
atatcagttgtttttgtcatattaaagctcagttgactatttttaccccacaattggtgt  c.120+1020

         .         .         .         .         .         .  g.21206
aaaagcatttttttaatagaatgtttctttatcaacagggtgtttattatctgttttaac  c.120+1080

         .         .         .         .         .         .  g.21266
tgtactatgagattcttacacaggggaaatgataatactaatttcttacgattttaggac  c.120+1140

         .         .         .         .         .         .  g.21326
cttttatgattaataaagcatttcacacatttaatttaatcttcttaatgatcctgttat  c.120+1200

         .         .         .         .         .         .  g.21386
ttgttaaagcaaatattcccatttacaacagagaaaacttagcgtcagggaagttatgtg  c.120+1260

         .         .         .         .         .         .  g.21446
atttgaccaaggtcacatgatttttttttcttttcaacttgtgttttaggtcaaggggta  c.120+1320

         .         .         .         .         .         .  g.21506
catgtgcaggtttgtttgtttgtttttcttttcaacttgtgttttaggtcaaggggtaca  c.120+1380

         .         .         .         .         .         .  g.21566
tgtgcaggtttgttacatgggtagattgcatgtcataggggtttgatggatagattattt  c.120+1440

         .         .         .         .         .         .  g.21626
tgtcacctaggtaagaagcatagtacccaataggtagtttttcaatccttgctctcctcc  c.120+1500

         .         .         .         .         .         .  g.21686
cacccgccactctcaaatagaccccagtgtctattgttcccttatttgtgtccatgtgta  c.120+1560

         .         .         .         .         .         .  g.21746
cactgtgtttagctcccacttataagtgagaacttgtgggttttcattttctgtttctgc  c.120+1620

         .         .         .         .         .         .  g.21806
attaattgggttaggctaacggcctccagctccatccatgttgctgcaaaggccatgttc  c.120+1680

         .         .         .         .         .         .  g.21866
tcattcttttttatggctgtgtagtattccatggtgtatccataccacattttctttatc  c.120+1740

         .         .         .         .         .         .  g.21926
cagtctactgctgatgggcatctaggttgattccatgtctttgctattgtgaatagtgct  c.120+1800

         .         .         .         .         .         .  g.21986
gtgatgaatatatgtgtgcatgtgtctttatggcagaacaatttatattcctttgggtat  c.120+1860

         .         .         .         .         .         .  g.22046
atacccagtaatgaaattgctgagttgaatggtagttctattttatgttgtttgaaaaat  c.120+1920

         .         .         .         .         .         .  g.22106
ctctttctgcagtggctgaactaatttacattctcaccagccatatgtaagtgttccctt  c.120+1980

         .         .         .         .         .         .  g.22166
ttctctgcaaccttgccagcatctgttattttttgactttttaatagtaatagccattct  c.120+2040

         .         .         .         .         .         .  g.22226
gactagtgcgagatggtatttcattgtggttttgatttacatttccctaatgattagtga  c.120+2100

         .         .         .         .         .         .  g.22286
tgttgagcatttttttcatatgcttgttggctgcatgtatgtcttcttttgagaagtgtc  c.120+2160

         .         .         .         .         .         .  g.22346
tgttcacgtcctttacccattttttaaatggggttgttttttgcttgttgattagcttac  c.120+2220

         .         .         .         .         .         .  g.22406
attccttatagattctggatattagccctttgtcagatgcatagtttgcaaatattttct  c.120+2280

         .         .         .         .         .         .  g.22466
cccattctgtaggttatctgtttactctgttgataatttcttttgctgtggagaagctct  c.120+2340

         .         .         .         .         .         .  g.22526
ttcatttaattaggcccactggtcaaattttgttgttttgcagttgcttttgtagtcttc  c.120+2400

         .         .         .         .         .         .  g.22586
atgaagtctttgcacagaccaatgcccagatggtatttcctatgttttcttgtagggctt  c.120+2460

         .         .         .         .         .         .  g.22646
ttatagttttaggttttacatgtaagtctttaattcatcttgagttgatttttgtgtgtg  c.120+2520

         .         .         .         .         .         .  g.22706
gtgtaaggaaggggtccagtgtcaatcttctgtatatggctagccaattatcccagcacc  c.120+2580

         .         .         .         .         .         .  g.22766
atttattgaatagtgagtcctttccccattgcttgtttttgtcaaagatcagatggttgt  c.120+2640

         .         .         .         .         .         .  g.22826
aggtgtgtggctttatttctgggttctctaacctgttccattggtctatgtgtctgtttc  c.120+2700

         .         .         .         .         .         .  g.22886
tgtagaagtaccatgctgtttggttactgtagccttgaaatatagtttgaagtcaggtaa  c.120+2760

         .         .         .         .         .         .  g.22946
tatgatgcctccagctttgtttctttggcttaggattgctttggctacttgggctctttt  c.120+2820

         .         .         .         .         .         .  g.23006
tgtttccaaatgaattttagaattttttttctaattctatgaaaaatgtcattggtagtt  c.120+2880

         .         .         .         .         .         .  g.23066
tgatagaaataacattgaatctgtaaattgctttgggcaatatggccattttaacaatat  c.120+2940

         .         .         .         .         .         .  g.23126
ttattcttcctattcatgaacaaggaatgtttttccatttgttttgttgtctctgatttt  c.120+3000

         .         .         .         .         .         .  g.23186
tttcagcagtgttttgtaatgctcacagagatcttttacttccctggttagctgtattcc  c.120+3060

         .         .         .         .         .         .  g.23246
taggtgttttattctttttgtggctactttttttttttttttttttgagatggagtctca  c.120+3120

         .         .         .         .         .         .  g.23306
ctcttatcacccaggctagcatgcagtggcgtgatctcagctcactacaacctccgcctc  c.120+3180

         .         .         .         .         .         .  g.23366
ctggattcaagcgattctcctgcctcagcctcccgagtagctgggattataggcgcctgc  c.120+3240

         .         .         .         .         .         .  g.23426
caccacatctgactaatttctgtatttttagtagagaatttcactatgttgctcaggctg  c.120+3300

         .         .         .         .         .         .  g.23486
gtctcagactcctgaccaccagtgatccgcctgcctcagcctcccaaagtgctgggatta  c.120+3360

         .         .         .         .         .         .  g.23546
caggtgtgagccaccacgccgggcctttttgtgaatgggattgctttcttaatttgctgt  c.120+3420

         .         .         .         .         .         .  g.23606
cagcgtggatgttatttgtgtatggaaatgctactgatttttgcacattgattttgtatc  c.120+3480

         .         .         .         .         .         .  g.23666
ctgaaactttgctgaagattattagagatcttttctaggtatagtatcttactgtctgtg  c.120+3540

         .         .         .         .         .         .  g.23726
aagagagacactttgacttcctcttttcctgtttggatgcctttatttctttatcttctc  c.120+3600

         .         .         .         .         .         .  g.23786
tgattgctctggctagacttccaatactatattgaataggagtggtgagagtgggcatcc  c.120+3660

         .         .         .         .         .         .  g.23846
ttgtcttgttcctgttttcaaggggaaagcttccagcttttacccattccgtatgatgtt  c.120+3720

         .         .         .         .         .         .  g.23906
agctatgggtttgtcatagacggcttttattattttgaggtgtgtacctttgatgcctaa  c.120+3780

         .         .         .         .         .         .  g.23966
tttgttgatagtttttaacatgaaaggatgctgaattttatcagaagccctttttttttt  c.120+3840

         .         .         .         .         .         .  g.24026
tttgcttctattcaggtgatcatgtggtttttgaaaaagccctggacagatagattcata  c.120+3900

         .         .        g.24052
gccaaattctaccagatgtgtaaagc  c.120+3926

--------------------- middle of intron ---------------------
                       g.24053          .         .           g.24077
                       c.121-3925  gctggttccagtcctagtgaaaccc  c.121-3901

.         .         .         .         .         .           g.24137
ttccaaaaaattgaggaagagggactgctccctaactcattctgtgaggccagtatcatt  c.121-3841

.         .         .         .         .         .           g.24197
ctgataccaaaacctggcagagacacaacaaaaaaagaaaacgtcaggccagtatccctg  c.121-3781

.         .         .         .         .         .           g.24257
atgaacatagatgtaaaaatcttcaacaaaaacgctagcaaaccaaattcagcagcacat  c.121-3721

.         .         .         .         .         .           g.24317
caaaagctaatccaccacagttaagtaggctttattcttaggaggcaaggttggttcatc  c.121-3661

.         .         .         .         .         .           g.24377
ataagcaaatcaataaatgcgattcatcacctaaacacgtgattattaaaaagtaaagtt  c.121-3601

.         .         .         .         .         .           g.24437
agaatccaaattttctgaatcattgaatatttctcactttactgttttatattacacagc  c.121-3541

.         .         .         .         .         .           g.24497
cctgtgcattatgatgtgtgtatttggcaataatgaggatcatttgtgacacatttaaag  c.121-3481

.         .         .         .         .         .           g.24557
tgctacctaatcctgtggtagcactcaaagtccttgtgactttgagctctgaatgacagg  c.121-3421

.         .         .         .         .         .           g.24617
cataaggttaacactggtcacgagaaccaaagtgttgaagttcatctcttctccaccact  c.121-3361

.         .         .         .         .         .           g.24677
agccagttgtggggcttagtgaacctcgctgtgctcagcctcctcatctgtaagatgggg  c.121-3301

.         .         .         .         .         .           g.24737
tagtaggacctacctcacagggctgttttgaagattaagtgtgcctgtttatagcttaga  c.121-3241

.         .         .         .         .         .           g.24797
acaatgccaggtcctgtttaaacgtttacctgataagacaagaacaattcctataagcag  c.121-3181

.         .         .         .         .         .           g.24857
ccttttaagaggttgcataagccatctttcctacctgaacaaatcaaagtaaagaggaac  c.121-3121

.         .         .         .         .         .           g.24917
tgcttttgtctgttacatttgttttatggaggtagttgacttcatatgaagtagttgatg  c.121-3061

.         .         .         .         .         .           g.24977
ataatgatgaaaaaagggtaggtgccaatattattgagcatttgctttgtgcagaccctg  c.121-3001

.         .         .         .         .         .           g.25037
tgctcagcattttactatcttgttcaacctacaacacaatcctgtgaagtgggtcttgtc  c.121-2941

.         .         .         .         .         .           g.25097
attattattcctattccagttgaaacaggcctgagctagttggtggtgcaggcagaatta  c.121-2881

.         .         .         .         .         .           g.25157
gagcccagggccgactgagtgtaatcatgaacacatctcattattttattcagaatctct  c.121-2821

.         .         .         .         .         .           g.25217
agggcagtggtgggtacttgtgactgggtggaagattccattttacttctcttcccttta  c.121-2761

.         .         .         .         .         .           g.25277
aaagattccatataaaattctttcgagggtgtcatatcttcttttaatgaaggacttatg  c.121-2701

.         .         .         .         .         .           g.25337
aactaagcattacatgtatggattgcaagtgttgttcaaatcttttgtgacttaaaaaat  c.121-2641

.         .         .         .         .         .           g.25397
aaaacctgtgtcaaagggtgactttaatgtgccttttcctggctagcataggagctttct  c.121-2581

.         .         .         .         .         .           g.25457
gtggggtagagattaatggcaaatctctttcgtatctgaatagcaattcagttgacttat  c.121-2521

.         .         .         .         .         .           g.25517
aaaaccttgacagtgagcacattttgattgatattgatagcgtaagaaacatctggtagc  c.121-2461

.         .         .         .         .         .           g.25577
agaaataataaaacaaaccatgtgtttccttcattttaggaagaactaagtcttttcaca  c.121-2401

.         .         .         .         .         .           g.25637
agggaagctggagacagaattttaattgttctgttaatttagtctaattttctttctcac  c.121-2341

.         .         .         .         .         .           g.25697
aggggaaattagtcaagaccattttggttccatctcaattcaccttattcaactgtttct  c.121-2281

.         .         .         .         .         .           g.25757
tgcatatttgatttttacagtttacaaattgaaccccttgaaatggctaatcatttccta  c.121-2221

.         .         .         .         .         .           g.25817
gctattgtgtcagtcaacagagctgctgtgtttaatggcaaagagaaagatgtatcattt  c.121-2161

.         .         .         .         .         .           g.25877
ttgttgctattctttgatttcacaaagatagctatctgatggaaagtccagttggctttt  c.121-2101

.         .         .         .         .         .           g.25937
cagcttcagttgcttagtctagaactgtagcattctggatatttttcatcttttaacttg  c.121-2041

.         .         .         .         .         .           g.25997
ttgatgaaggtgacttttgctttctatattattttttagctcactctcaaaatctattca  c.121-1981

.         .         .         .         .         .           g.26057
catctaatgatgtgtattttttaaagcatgcttcccgaggaaggctgggcaggcgttatc  c.121-1921

.         .         .         .         .         .           g.26117
atggcggtgtgaggaagagcattgggaccgagttaggagacctggtttgtaattctggtt  c.121-1861

.         .         .         .         .         .           g.26177
ctgtggccagaatgactgctggaccttgggaaaatgatttatcttttctgagcctctgtt  c.121-1801

.         .         .         .         .         .           g.26237
atctcatttgcaaaaggggagtgttgggttgaatcatctccaatgctgtttttagatcta  c.121-1741

.         .         .         .         .         .           g.26297
acaattctatttttccaggagcctcagctggcagccaaagctgtggcatccagaaggcag  c.121-1681

.         .         .         .         .         .           g.26357
cttggcctggggcaagtggtgggttgccagtggagccaaatggctcctctggagctgagg  c.121-1621

.         .         .         .         .         .           g.26417
ctggccccttccctgagggcaggttgtcttcctggtcaagagtggcatttagagtaagtc  c.121-1561

.         .         .         .         .         .           g.26477
tgcgcatgctgacttacggtgataacctggctttggttcagtgcattcagggaactggat  c.121-1501

.         .         .         .         .         .           g.26537
tgaactttccagtcttttttagtaatttcttccagatctacctgtttcatcaggattaag  c.121-1441

.         .         .         .         .         .           g.26597
ttaggtgtcacttgatccatcgtgagagttaacaaatcagcatataactataggttctcc  c.121-1381

.         .         .         .         .         .           g.26657
tctactcagtggcatttctagtctcgagacaaagataatttcagaatatgccactaaagg  c.121-1321

.         .         .         .         .         .           g.26717
tagtccctcccctgtgtttagctctctcttccccgagtgttgtcatggtccctttggtat  c.121-1261

.         .         .         .         .         .           g.26777
tcttagaggatgcatctctgtggatacgtctcttggcttttaagccgctcccaattttgt  c.121-1201

.         .         .         .         .         .           g.26837
tggtaagggctcacgaccacatttcttgttgcagtctgtgaagaaaattgaaggatattt  c.121-1141

.         .         .         .         .         .           g.26897
gccaccatcccgttgtcataattatagcatatgactgttgaaagcaagaaagggcaatta  c.121-1081

.         .         .         .         .         .           g.26957
gggagaaaattccttcttagtctgcagagaagacaatgaaaatggcacatttagctgctg  c.121-1021

.         .         .         .         .         .           g.27017
acactttgcactttgccagataaatcttttgagagttcctccgttgatttacacagagtc  c.121-961

.         .         .         .         .         .           g.27077
gaggtcaggtatttctgtgcccacatccagatttctgtgtctggagctctccagctctta  c.121-901

.         .         .         .         .         .           g.27137
aggtgccccttctgtgctcctgattttttttttttttttttttttgatatggagtcttgc  c.121-841

.         .         .         .         .         .           g.27197
tctgttgcccaggctggaatgcagtgacacgatctcagctcactgcaacctccgcctcct  c.121-781

.         .         .         .         .         .           g.27257
gggttcaagcgattgtcctgcctcagcctcctgattagctgggactacaggcgcctgcca  c.121-721

.         .         .         .         .         .           g.27317
tcatgcccggctaacttttgtatttttagtagcggtggggttttccgtattggccaggct  c.121-661

.         .         .         .         .         .           g.27377
ggtcttgaactcctgaccttgtgatccacctgcctcgacctcccaaagtgctggggttac  c.121-601

.         .         .         .         .         .           g.27437
aggtatgagccaccgcacccggcctctgtgctcctgaattctggtgaccaccataggctg  c.121-541

.         .         .         .         .         .           g.27497
gcctctgaggccctttgcaggcccctaggactactcctcaggttggagagaacattgtgg  c.121-481

.         .         .         .         .         .           g.27557
taacattcttgaagatagcatgactgcacccaaaagatgataaagtgcaataattagtag  c.121-421

.         .         .         .         .         .           g.27617
aacttatcttcatgaggagcaccctgccaggttcgagactatcctctgatatgttcctaa  c.121-361

.         .         .         .         .         .           g.27677
tgctttatggtttacagggctttaaaaatggaccctcctgagaatatcatgaaccagtta  c.121-301

.         .         .         .         .         .           g.27737
aacattcactgcatcttacacaataggaaagagcttcagctcaatcaattgacttgccca  c.121-241

.         .         .         .         .         .           g.27797
agatcacatgagaagggcacagccccaactaagaagtctgtcatgatacagaagtacatc  c.121-181

.         .         .         .         .         .           g.27857
attgctccgtggtcccttaggtttcggtctcatttctttagggaagcgtttccaagctcc  c.121-121

.         .         .         .         .         .           g.27917
gtttttcaaatcttcctcccatgtgctgatacataccatgcaccatgcatgtttactcag  c.121-61

.         .         .         .         .         .           g.27977
tgtactgctggctttgttatgtactgagattcatctttttctctttcatttaaaatacag  c.121-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center