beta 3-glucosyltransferase (B3GLCT) - 6193 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.28077
gtaagtaatgattttttttacctaagagtgtgtacttaggtatattttgtatgaattata  c.160+60

         .         .         .         .         .         .  g.28137
tttccatgaagtgatttttttctgattttatttatggggtaaatattgttgttcaaatat  c.160+120

         .         .         .         .         .         .  g.28197
tctgtctttggcccagcctaacgtttgctctcctgaagatgtggggcaaacacctctcag  c.160+180

         .         .         .         .         .         .  g.28257
atgggcatgttggcatgtggtggatttatgtttacttagtgagatatgttggatttaatt  c.160+240

         .         .         .         .         .         .  g.28317
ccctctggcatcattcattgagcttccagtaaggataaagcaccatgcctggtgggctct  c.160+300

         .         .         .         .         .         .  g.28377
ctgggggaatgcagaggggaaggagacatggtccctgttattaaggacccacatgatgtg  c.160+360

         .         .         .         .         .         .  g.28437
ggagaacagaacaagctgtgacattagcgcaggccgtccgggagcaggctgtccacttgc  c.160+420

         .         .         .         .         .         .  g.28497
tgacctgcagacacctccatgcctttcaggagtcagctcaccagtcacgtctgccaaact  c.160+480

         .         .         .         .         .         .  g.28557
tgtcccgagcatcctggcctggaagccgttactccttcctttgtaaggcatcatacttct  c.160+540

         .         .         .         .         .         .  g.28617
atcattgcccattccttatttgtactccttttgaaacaccctctccgccatagtttgtaa  c.160+600

         .         .         .         .         .         .  g.28677
gtatcttcagaaatgtgaccaggagttagactttaaaaaaaaattaatgggaagcatgcc  c.160+660

         .         .         .         .         .         .  g.28737
cagtgtgtaaggccacacctctgtgtgtaggggtgagtttgtccttgaagggtgtgaatt  c.160+720

         .         .         .         .         .         .  g.28797
ttgtcaatgtctttcctcccagggtaggaggaatgacccaagtctggaacacaatcagcc  c.160+780

         .         .         .         .         .         .  g.28857
aggacctggacaccagtagcagtggaacctcacaggaagcctatggtgtcagggggtatg  c.160+840

         .         .         .         .         .         .  g.28917
cggtccatgggagaagtctcccttcagacacagggggttggctcacctccagtttcatga  c.160+900

         .         .         .         .         .         .  g.28977
tggataagcctgggttccaggaaacaagaagggaacaatatgctcttcttgcttcctctc  c.160+960

         .         .         .         .         .         .  g.29037
cactattttccatggagacctggaaggcgagctctagataagagggaaaaggataaagga  c.160+1020

         .         .         .         .         .         .  g.29097
aagtgttcctttctaggccttcccttcctgggcctgggttctgaggggtgcagaagttca  c.160+1080

         .         .         .         .         .         .  g.29157
ggagagacccccgcccccgggtggaagtgggaggatgacctgtcttgggcacgcatatct  c.160+1140

         .         .         .         .         .         .  g.29217
agggcccacaggggagtgttttggggtctgcgagcagctgtatttaaggaaccacgtcaa  c.160+1200

         .         .         .         .         .         .  g.29277
tttgttgctttttctttctattataacaccctgtatggtttagccacgcctttccatgtg  c.160+1260

         .         .         .         .         .         .  g.29337
gagattttcttccctgctaccaactctgtggctttgagcatttatttgtagtttatggga  c.160+1320

         .         .         .         .         .         .  g.29397
gcagatgagtctctggttattaaatgaattaatgatgcaagtctggaacatgggcttgaa  c.160+1380

         .         .         .         .         .         .  g.29457
actacaaaggggaagttaccttggacaagtaaatttatattcttgcaattgcacatggca  c.160+1440

         .         .         .         .         .         .  g.29517
agtcgagtgatacctaacttggtatcagttcatctgaaaaagacccaggggacttctttg  c.160+1500

         .         .         .         .         .         .  g.29577
tcacaatctttgtgtgagcctgcaagaccaggaggctactaaagatcctgggcagttgca  c.160+1560

         .         .         .         .         .         .  g.29637
gtgacaacagtagattcagggcaccgagagcatggctcacagtcagagctgggagatagc  c.160+1620

         .         .         .         .         .         .  g.29697
ctccatgcacgggatgctgtttctccttcagcttgctgcctaattgatagattcactagt  c.160+1680

         .         .         .         .         .         .  g.29757
atatgattattctcaccaagtaaacataattggagtggcccgctttgtgtgtgtgtgttt  c.160+1740

         .         .         .         .         .         .  g.29817
gtgggtgtgtgtgtatgcatgcatattttttcctcaactttaaatcataaggctgcttgt  c.160+1800

         .         .         .         .         .         .  g.29877
tacagcttatatcagaagtacatcgtattggtttttcatcagaaaaacaccagcatgatg  c.160+1860

         .         .         .         .         .         .  g.29937
aaacccatttttctaggtaatttctgaccaggaagatgagcactttacagtacagtgctt  c.160+1920

         .         .         .         .         .         .  g.29997
ggcccatggtaggtgctcagcaactgaagacatagagagcattggtttcttctgctttca  c.160+1980

         .         .         .         .         .         .  g.30057
tagaagaatcattgctcttcagcatccattttctaactatctctctgtcctgctgccttt  c.160+2040

         .         .         .         .         .         .  g.30117
cctgagcactgtctgccactcaccattggctttggcattgcattggccctttaggtatcc  c.160+2100

         .         .         .         .         .         .  g.30177
tttgctaatttctttatcttccccttttagcctgtcactctgattattattgtcaggcac  c.160+2160

         .         .         .         .         .         .  g.30237
ttagtgtgcggcccatttattgcccattcctgggggagaaacaatgacaatccatcttga  c.160+2220

         .         .         .         .         .         .  g.30297
gttgtgacagtgtttgctgaaggcagattgcagtgagtttaaagaagtgcaaccaagatg  c.160+2280

         .         .         .         .         .         .  g.30357
ataaggaaatcatggaattgtcttatttagctctgtggactgggcagcaggagcttaaga  c.160+2340

         .         .         .         .         .         .  g.30417
gtcaggtggttggatggcatacacagagaagacagctaccaagataagctctgggatctg  c.160+2400

         .         .         .         .         .         .  g.30477
gactcagccagaatgtgattcagtgaagggatggcttaggctgtatgtcagaaaatattt  c.160+2460

         .         .         .         .         .         .  g.30537
cttggtactgctataaagaacagcaggaatttaaacacataagctgttttcagcaccgaa  c.160+2520

         .         .         .         .         .         .  g.30597
ctgtactaactatactaacctggttcttttctggaatgggttggggctgactagcatgtc  c.160+2580

         .         .         .         .         .         .  g.30657
agtgatcttccggcattcattatgatcagggttgcaggagctcccctcccctttagcctt  c.160+2640

         .         .         .         .         .         .  g.30717
gtcctcgataatacccccatgcgtcctgttccttggctatacctaaccgttagtattttc  c.160+2700

         .         .         .         .         .         .  g.30777
ctgccctaaatttgattctgtcccaaactttcactgctccctctgtggggagggtcttcc  c.160+2760

         .         .         .         .         .         .  g.30837
caccccttttttcccccatcttcgggacagtgtcctccttccctcctttgggaagtcccc  c.160+2820

         .         .         .         .         .         .  g.30897
actgcctgggaccccacttggctcatgaggcccttcccccatttgaaagtgattaatcta  c.160+2880

         .         .         .         .         .         .  g.30957
gagcccaagcctctcagcatggtatataaatccctcatgatttgtcttaacggatctgcc  c.160+2940

         .         .         .         .         .         .  g.31017
tccgtttctaactttatcacctactgtaccccgccgtgctccttttctcagaaatgcctg  c.160+3000

         .         .         .         .         .         .  g.31077
acagacatggtcgttcactcagggagactgcagagataccacaggctgtgggctctgtgg  c.160+3060

         .         .         .         g.31114
tgatcccactgatctgctaccctctgtgtgtgtgtct  c.160+3097

--------------------- middle of intron ---------------------
            g.31115           .         .         .           g.31150
            c.161-3096  gctgctttttaaaggaaactcaggaaataacctcct  c.161-3061

.         .         .         .         .         .           g.31210
cctggaagctctccttgcactcgcccccgattgtctgggctccagtgccctgtgctcagt  c.161-3001

.         .         .         .         .         .           g.31270
tagctctggctttccacttactgctttgtgttacaatggcctgcctatgaacgaggctca  c.161-2941

.         .         .         .         .         .           g.31330
gacactccagggctgcgactgggctcactcgttcttgtatcacagagccctacacttagt  c.161-2881

.         .         .         .         .         .           g.31390
aggtactcagaagatgtttgctgaatgaatgaatgaagcgtgcatgattgaagtatagga  c.161-2821

.         .         .         .         .         .           g.31450
aaaagggagaggccagcatgatttcttagtggctatgttaaaaagaggacagatacaact  c.161-2761

.         .         .         .         .         .           g.31510
cacaggacatgacccaggtatgggaagaatttgctctttaatcttgcaaatcctcttccc  c.161-2701

.         .         .         .         .         .           g.31570
tgtatggaaatgctgttgtcttcaatgagaagacagtgggagctttgctgagctggtagg  c.161-2641

.         .         .         .         .         .           g.31630
agtggcaggagttggttactgtgatgagcggtgagcgcaggattaagctttttttttatt  c.161-2581

.         .         .         .         .         .           g.31690
tttatttttttttagagatgtagtcttgctgtgttgctcaggctgacctcaaactcctgg  c.161-2521

.         .         .         .         .         .           g.31750
gcccaagcaatcctcccacttcagcttcccaagtagctgagacttcaggtgcatgccacc  c.161-2461

.         .         .         .         .         .           g.31810
atgcccagctaggattaaccttttgatagagaaatctactctttaaaaaaagtattagga  c.161-2401

.         .         .         .         .         .           g.31870
aataatttgaacatataagaagttataaagagaataatataatgaacattcatgtattat  c.161-2341

.         .         .         .         .         .           g.31930
atgttcattagattaagaaataaaatatcacctagattaagaaattaaataccattaaca  c.161-2281

.         .         .         .         .         .           g.31990
cagctgaaaccttttaaccattatcctgatttggtatttatcatactcatgtaatctttt  c.161-2221

.         .         .         .         .         .           g.32050
ataccttcacatgctatgtgtgtatatgtttggtatatatacattttaatatatttatgt  c.161-2161

.         .         .         .         .         .           g.32110
ttatattgttgcaaactattatatagttattcttttgcaacttgcttttttcagcattat  c.161-2101

.         .         .         .         .         .           g.32170
gactatgggatttatccatctggattgatacatgtagtactggttaatttttattgctgc  c.161-2041

.         .         .         .         .         .           g.32230
atagtattcaagttaatgtatcttgttagtggatatttttgttgcttcccatttttttct  c.161-1981

.         .         .         .         .         .           g.32290
tttacacagtgccactgtaaacacttttgtcatatatccttgtgcacacatctgagtttc  c.161-1921

.         .         .         .         .         .           g.32350
tcaaggatgattaataagagtggaatttctgggtcattgggaatgtgcatcttctttatt  c.161-1861

.         .         .         .         .         .           g.32410
aaattaaaaaaaaaattattctctgaggcttatttactccattcttaacaaaaagaaatc  c.161-1801

.         .         .         .         .         .           g.32470
cttataactcctctttagatgtgtcagtttatattaatgtttcagatgtagtagatccaa  c.161-1741

.         .         .         .         .         .           g.32530
gataagaattcagttgaaactgaagacacccatttaagtcttacccatgtgtccaacata  c.161-1681

.         .         .         .         .         .           g.32590
taaagccgagaagctggtttaaaatagagacaggtatatggaatgttcctatttatataa  c.161-1621

.         .         .         .         .         .           g.32650
actcctaaagaaaaggaattaggtcatattcagtaggctgttcagcatttccttttacat  c.161-1561

.         .         .         .         .         .           g.32710
attttatttagttttaaccaaagagcattttagattatttttaggatctagatggctcac  c.161-1501

.         .         .         .         .         .           g.32770
tgtggagctatctgttgtgtgaatatttgagcaagtgaataaatgaatggacctatagaa  c.161-1441

.         .         .         .         .         .           g.32830
tagagcataagaacaataaaatataatggaataaaattaaaatcaaattaggttctctga  c.161-1381

.         .         .         .         .         .           g.32890
gctgaggtgttaaagagaaagattcatggtgggggaaaggtccccacatggctttgctga  c.161-1321

.         .         .         .         .         .           g.32950
caatctggctgaaggctagaatttacgtggcaccttcctctgccgacattcctgtctggt  c.161-1261

.         .         .         .         .         .           g.33010
ggcagggtgctgacacaatcactgttttatccatttctttgttataggcccagaacctgg  c.161-1201

.         .         .         .         .         .           g.33070
ggaggcctaacgtgtttctctgggaggcagccttgctactgccattggcaagccctctga  c.161-1141

.         .         .         .         .         .           g.33130
tggtctttgtgggcaggacatactcgggtttccttcctgttcgccgttgtaaaaagctgg  c.161-1081

.         .         .         .         .         .           g.33190
ctgccttcaggtgcatctctagcaggctggtgaatactgccagcatggggtgttatagat  c.161-1021

.         .         .         .         .         .           g.33250
gggctttatgcaggacttcacgctaaagccctgttgctgaggaattgctgtggccgtttc  c.161-961

.         .         .         .         .         .           g.33310
ctggagataacacctaatcctggctaggtgccttatgaggtagggtagggattattgagt  c.161-901

.         .         .         .         .         .           g.33370
tacttatttgcaaacccttctgaactcatgggagatgggcagttactgttgagtgtcacc  c.161-841

.         .         .         .         .         .           g.33430
ttaaaggaccattcagaacattcttgaagtagtgtagtagtgagctaggactacataaca  c.161-781

.         .         .         .         .         .           g.33490
aagtaccacaaaacgtggcttagtacaagcaacagaaatgtattgtctcacagttctgga  c.161-721

.         .         .         .         .         .           g.33550
ggttagaagtctgacatcaaggtgtgggcagggttggttccttctgagagctgggaagga  c.161-661

.         .         .         .         .         .           g.33610
aggatctgttccaggcctctgtctttggcttgtagatggctatcttctctgtgtgtctcc  c.161-601

.         .         .         .         .         .           g.33670
tcatatcatcttccttctctgtgtgtcatttatgtgtccaaatttctaaggagactggtt  c.161-541

.         .         .         .         .         .           g.33730
atattggattaaggttcaccctgatgacctcgctttaacttgattacctctgtgaagacc  c.161-481

.         .         .         .         .         .           g.33790
caattctaaatgaagtcacattctgaggtattgggggttaggacttaaaaaatatgaatt  c.161-421

.         .         .         .         .         .           g.33850
ttagaggacatgtttcaactcataacaggtagcagcacagtgtaggattatgtgggaatt  c.161-361

.         .         .         .         .         .           g.33910
gttaaaaagctacttgtgaaagttagattttcagctactgggaagattagtgttctagat  c.161-301

.         .         .         .         .         .           g.33970
attttcacacattttcagccattctttctgacatatgcgggagcacattctcagtttggt  c.161-241

.         .         .         .         .         .           g.34030
gccatagactgggtctggtacagtcagcttatttacttgctaacttctaggaaggaagct  c.161-181

.         .         .         .         .         .           g.34090
tgggaaacagtttaaaaagagagaaaattttgtctctagaattacatacgaattgatttt  c.161-121

.         .         .         .         .         .           g.34150
ttcccattaagagtttactgcctgaaggtttgctttgtagctattttttcacttgttttc  c.161-61

.         .         .         .         .         .           g.34210
aagtttattttaataattttgtaaaaagaaatacctgaaaactatttttttttgttctag  c.161-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center