beta 3-glucosyltransferase (B3GLCT) - 755 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.52185
gtacgtttgtttaactcacctgtgaattactgacattcctacctgaacacttttacgccc  c.347+60

         .         .         .         .         .         .  g.52245
ttagtctttttattaagagggtgtggttttcctcagtcagtaagtgaagtaaatttgagt  c.347+120

         .         .         .         .         .         .  g.52305
tttactttttatgattactaccttaaccaaatttcttgatgattggttcttaatcatgaa  c.347+180

         .         .         .         .         .         .  g.52365
tagctttttctttttttttggagacagagtctcgctctgtcgccaggctggaatgcagtg  c.347+240

         .         .         .         .         .         .  g.52425
gtgacttggctcctgcaagctctgcctcatgggttcaagcaattccctgcctcagcctcc  c.347+300

         .         .         .         .         .         .  g.52485
cgagtagctgtgactacaggcgtgcaccaccactcccagttatttttttatttttagtat  c.347+360

         .          g.52503
agatgagattttaccatg  c.347+378

--------------------- middle of intron ---------------------
                                g.52504           .           g.52520
                                c.348-377  ttggccaggatggcctt  c.348-361

.         .         .         .         .         .           g.52580
gatctgttgaccttgtgatccgtctgccttggcctcccaaagtgctgggataacaggcgt  c.348-301

.         .         .         .         .         .           g.52640
gagccaccacaccctgccctatatatgctttttcttaaagaataaaatgcttcaagttga  c.348-241

.         .         .         .         .         .           g.52700
tatttgaaaattatttatcccctgaactagtgttgttatggagagaattaactttacgaa  c.348-181

.         .         .         .         .         .           g.52760
ctccagctgttttttaaaccattagcatctggcttttctataagctgaagaaaaatatag  c.348-121

.         .         .         .         .         .           g.52820
agaaaaaaattagatatgccattctgtgtacccttcattcacttcctactgatcagtttt  c.348-61

.         .         .         .         .         .           g.52880
aaaccttattattaacttattttacagaagtgattactgaaacttgtttcttttggtcag  c.348-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center