beta 3-glucosyltransferase (B3GLCT) - 8131 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.66168
gtaagaatttattggaattttttcggggggcgggaggggtgtgcatcaactttaatttca  c.596+60

         .         .         .         .         .         .  g.66228
ttgagtactgtaactgatggatctcaggatctcaaatgagtttttcagccagaggcagtg  c.596+120

         .         .         .         .         .         .  g.66288
tgtggtaagatctggaaaaggagccagatgcttgagggtttctgcttcagcgctgtcatt  c.596+180

         .         .         .         .         .         .  g.66348
tactagacccttcagacaaatcattcaacctctctgtatttcttctcactcatccaaaga  c.596+240

         .         .         .         .         .         .  g.66408
taacaagttgtgagactaagggagaacacagaattgctctgagaaccatgcacatgggag  c.596+300

         .         .         .         .         .         .  g.66468
catcattactgttgttaagggatctacttagctataggtgtaactttgatcaccagtaag  c.596+360

         .         .         .         .         .         .  g.66528
aaaatgaagcagtaacttgctggggttgagagttgatgactcattaggtgcatgggtatg  c.596+420

         .         .         .         .         .         .  g.66588
catacttaaacactggccagtcaggagggacagctagtggaaggtactataggtcgtcat  c.596+480

         .         .         .         .         .         .  g.66648
acctagctatttgtgtgtatattcacaatggtgctctgttagatgtggaaagtgaagata  c.596+540

         .         .         .         .         .         .  g.66708
gttaaattgtaattcaggagaagtatggttgttgacaagcccttcagattaatcattatg  c.596+600

         .         .         .         .         .         .  g.66768
tttttgttctttagggaatggaaagttgataaagcacttgtggcttttatatcttcagag  c.596+660

         .         .         .         .         .         .  g.66828
atgaaagagtttctatcattaagtgtcctgtctctaggatttggggtcttgaaaatctta  c.596+720

         .         .         .         .         .         .  g.66888
ttagcccattgtagatatacaggatattacataccttgtcattcacagctggacaaaact  c.596+780

         .         .         .         .         .         .  g.66948
tcttgactactcctttcacatttcaaagttctctacagtgtgataccctcctttccaggg  c.596+840

         .         .         .         .         .         .  g.67008
tagaatccaaacaacaacaacaaaaccccctgtgtttcctagctttccttgctactagga  c.596+900

         .         .         .         .         .         .  g.67068
agcagccgtatgttgtaggttccatcaggtagatgtgttatgtacaattatttttgggaa  c.596+960

         .         .         .         .         .         .  g.67128
ctgaattgtgtggggaaggagacaaagcatgggggaccatttgaattgagactcgtagca  c.596+1020

         .         .         .         .         .         .  g.67188
aaggaagagtcgtttgcagttgacagcggcttcctgatgatggcagagtctgaagctcct  c.596+1080

         .         .         .         .         .         .  g.67248
acgctgctgatttctgtggtacaaatctgggggttcttggaatctcagcttacagtctgt  c.596+1140

         .         .         .         .         .         .  g.67308
ttactcagactttccagtaattccatgagccatctatatgctttaataaatgtacgttat  c.596+1200

         .         .         .         .         .         .  g.67368
gctttaactagccagagtggattatttttgtttgtttccagttaagatcttcgactcacg  c.596+1260

         .         .         .         .         .         .  g.67428
cactcagtcctgggcctgccgggcaagaatgcccatctcccggcccctgccaagcatgcc  c.596+1320

         .         .         .         .         .         .  g.67488
taagagcatctgcacagtttccctcccttcattcttagaagggtcaaggaggaagaggag  c.596+1380

         .         .         .         .         .         .  g.67548
tgaagacaagaagaagtagtggtcattcccttctcaccgtctactggtctgcttaattct  c.596+1440

         .         .         .         .         .         .  g.67608
gtgctctgcaggggagaggggaatatgttctgcccttcagcagccttgggtcgtgtttct  c.596+1500

         .         .         .         .         .         .  g.67668
tctcaaattaaatacactttggtttgctacagcttgaggaccaggagctcccaggacatt  c.596+1560

         .         .         .         .         .         .  g.67728
catttcctgcagtgtccagcagccttatgtttggggccagtttagccacctttgttgagt  c.596+1620

         .         .         .         .         .         .  g.67788
ctggactcttaatgaatagaagctgtgacctgcactttgtaggctgagccactgttcctt  c.596+1680

         .         .         .         .         .         .  g.67848
ttcccttcctcaagtattcttctcatcctcggccacaggaggcttcctctagccttcctc  c.596+1740

         .         .         .         .         .         .  g.67908
atttgatctctacttagttttatagtatagaaagatttggtctgacttctccatgggaga  c.596+1800

         .         .         .         .         .         .  g.67968
agtcccacgtggctgtgatttttctgacttgggacttataacctctgtataagcctgttt  c.596+1860

         .         .         .         .         .         .  g.68028
ctctcccatttcccatgtgctatgaagtcccttgagagaggaacaaacacagctcttgcc  c.596+1920

         .         .         .         .         .         .  g.68088
tgccctgtaaagtgctgttaagtgcagcaggttcttcttcctccagggctaaagaggaaa  c.596+1980

         .         .         .         .         .         .  g.68148
ccagtgggcccaggtagagctatatggcaagcgggggtgtaatcatttccttgaagccag  c.596+2040

         .         .         .         .         .         .  g.68208
tgtagctcttttcttcatcactgccttctgatccaggaggcctctcatcctgaaggcaaa  c.596+2100

         .         .         .         .         .         .  g.68268
tccttatagtctagagttttaccttccttcttcccatcacaatttcctgtcttcctttag  c.596+2160

         .         .         .         .         .         .  g.68328
caagactttcttggagacctcttgatgctgaattcaattccgtttttgttgaattaggtg  c.596+2220

         .         .         .         .         .         .  g.68388
ttagaagtaactatttattcttgcttcctttgacttactgtctgaaccaggtgcaggttg  c.596+2280

         .         .         .         .         .         .  g.68448
atggaagtgatcctgtttgaacacatttttgactcctggcatccctatatagggcagttc  c.596+2340

         .         .         .         .         .         .  g.68508
aacctaactcttatggctgacatgctggcattaagtataacctgttctaggaaacctctg  c.596+2400

         .         .         .         .         .         .  g.68568
tcctctgcttcactgctcatcaagtgtagcagcacccagagcactggcaggctttgttgg  c.596+2460

         .         .         .         .         .         .  g.68628
ctctggctagtgctcacctcattactgtctcatgctcaccacatgactagcttccagggg  c.596+2520

         .         .         .         .         .         .  g.68688
ttcatgaaccagggttgcaggttgtgcactagctgagatgttagctttattaaggggcga  c.596+2580

         .         .         .         .         .         .  g.68748
ctgtatgttctggattatctggcattttgcaaggtagtcccacaggagaccacaggtcca  c.596+2640

         .         .         .         .         .         .  g.68808
tgattcccttccccattgtgtttgtgagatcattgaacacatctgttgacaagggaaggt  c.596+2700

         .         .         .         .         .         .  g.68868
agccagtgcccagcttccatagcggtttcacatctccctttctagtcaagtttaaccata  c.596+2760

         .         .         .         .         .         .  g.68928
tttaggagtgagaactgagggccttgtcactgcagcagggtgtgtaggcatcttagtctg  c.596+2820

         .         .         .         .         .         .  g.68988
tttgggctgctataaaaaaatgccataaaccaggtagcttataaacgacagcagtttatt  c.596+2880

         .         .         .         .         .         .  g.69048
tcttatagttctggaggctggaagtccaagataaggcgctggcagattcagtgtctggtg  c.596+2940

         .         .         .         .         .         .  g.69108
agtgccagttttctggttcctttccttcttgctgtgtcccctcatctgggagaagggacg  c.596+3000

         .         .         .         .         .         .  g.69168
aggggtcttttttataggggtgcagtcccattcatgagagttccctccccatggcctcat  c.596+3060

         .         .         .         .         .         .  g.69228
cacctcccaaagaccctgcctcctaataacattgccttgaggggtaggacttcagcctat  c.596+3120

         .         .         .         .         .         .  g.69288
gaatttgagaggggacacaaacattcagaccatagtaatagggaactatgactaagggaa  c.596+3180

         .         .         .         .         .         .  g.69348
ttaaagccaagaggttaatcttttccacaaagctcaggaaattcccagcacttccccgtg  c.596+3240

         .         .         .         .         .         .  g.69408
actccagtatgatagaggagtgaggcaccagatagccttctgcatggtgtgtcatctgct  c.596+3300

         .         .         .         .         .         .  g.69468
cgtcacaacgctcaacagtgaccaacaaaccgtagaatgtgtatagttcattgatatcca  c.596+3360

         .         .         .         .         .         .  g.69528
tggtcttctccctacctcctctccctttcctctgccaggaaaaaaaagcaaaataaatat  c.596+3420

         .         .         .         .         .         .  g.69588
gcagactctaccataatgccatatttaaaattctacttaccttagatcatatttcctttc  c.596+3480

         .         .         .         .         .         .  g.69648
ccccgatgccaacaagtaatcaagcaaatgatataacccatctagcatagcaactatctt  c.596+3540

         .         .         .         .         .         .  g.69708
gtggtcaagatatattttaaaatggctttctagtggggattcttatttattcttcaagaa  c.596+3600

         .         .         .         .         .         .  g.69768
actggtattatactcaggactaaaggaaggataaagtattcattagccccatcagctgca  c.596+3660

         .         .         .         .         .         .  g.69828
acattggatcttcctagttgttgttttcccaattcaaagctaatgtgctgactttatttc  c.596+3720

         .         .         .         .         .         .  g.69888
ttcctattattattagctatatcaattagcatgcttttggatgcaagtaataggaagcaa  c.596+3780

         .         .         .         .         .         .  g.69948
ctcaaactggattaaggaaatacttttgctgtaattggggtgaggtctgtggttggttga  c.596+3840

         .         .         .         .         .         .  g.70008
tctagcagtttatcaatatcattgaggacccacactttctctgtccctctagcctatagt  c.596+3900

         .         .         .         .         .         .  g.70068
acacagaatccatttatcctaaatctggttcctcttgtggtttcaagacaataagggcta  c.596+3960

         .         .         .         .         .         .  g.70128
catatttcctgtttgcatccaatagtagatagcctgttcccaaccatgaatggtaagtgc  c.596+4020

         .         .         .         .        g.70174
ttgtcctcagtctggttgggccaactgcatgtgtgttctaatctcc  c.596+4066

--------------------- middle of intron ---------------------
   g.70175          .         .         .         .           g.70219
   c.597-4065  agactattaacagttgcgcaggaatttcattgattattagaatta  c.597-4021

.         .         .         .         .         .           g.70279
ttagaattttcagttctaatccccagagtattaacagttgccagggaatttcattgatta  c.597-3961

.         .         .         .         .         .           g.70339
ttctggctggcccagagtaatcaatctctgactctggagcctgtataattgttgggctca  c.597-3901

.         .         .         .         .         .           g.70399
atattaatcaaaaccagaatttgtttagaaagaatgaaggggaaactctgtattatatag  c.597-3841

.         .         .         .         .         .           g.70459
acaaccaagaaggccagtccaggaatgttgattccctttgtgtcctttccttgactttac  c.597-3781

.         .         .         .         .         .           g.70519
ggcccacattgtaggtagcgtaacaacttacagttacttaggtgtttcttctgtcctagt  c.597-3721

.         .         .         .         .         .           g.70579
ccccaggacaactggttacctaaagatagctcatgagacacactttcttagactgtttcc  c.597-3661

.         .         .         .         .         .           g.70639
aaccaaaattttatttggcctaacaattccacatcagttttgagttcacactgcctaata  c.597-3601

.         .         .         .         .         .           g.70699
tttcctggcagtccatccatttgatcaattaaaacaatactttcatttttggagaaattt  c.597-3541

.         .         .         .         .         .           g.70759
tcattaactaccaataagatgatttcttcaaatatatgtcattccaggacactgtttctg  c.597-3481

.         .         .         .         .         .           g.70819
gttttctccattgtttttccaccagcaaaccttatcgagatttccttcagcaggtggctc  c.597-3421

.         .         .         .         .         .           g.70879
tgttgactgattcacaagtgggactgaaaaagttagcctggaagtgggactgaaaaagtt  c.597-3361

.         .         .         .         .         .           g.70939
agctaggaagtgggactgaaaaagtcagctaggaagtagaattgaaaaagtcagctaggt  c.597-3301

.         .         .         .         .         .           g.70999
attgagttgaaaggaccctcagtcatttgcacatctgtagcctaggtggttgtgtcatta  c.597-3241

.         .         .         .         .         .           g.71059
gaactgtgctattgggggcatgacttaacttcttttttttttttgaaacggagtctcgct  c.597-3181

.         .         .         .         .         .           g.71119
ctgtcgcccaggctggagtacagtggcgcagtctcgctcactgcaagttccacccccggg  c.597-3121

.         .         .         .         .         .           g.71179
ttcacgccattctcctgcctcagcctcccgagtagctgggactgcaggtgcccgccacca  c.597-3061

.         .         .         .         .         .           g.71239
cacccgcctaatatttttgtgtttttagtagagacggggtttcaccgtgttagccaggat  c.597-3001

.         .         .         .         .         .           g.71299
ggcctcgatctcctgacctcatgttttgcccgccttggcctcccaacctcgtgatccgcc  c.597-2941

.         .         .         .         .         .           g.71359
cacctcagcctcccaaagtactgggattacaggcatgagccaccacacccggcccaataa  c.597-2881

.         .         .         .         .         .           g.71419
ttctaaaaattaggaaagctaagtaccaaacttcgtgttttccaggaactgaatatttaa  c.597-2821

.         .         .         .         .         .           g.71479
tgaggaaacatttcatctaagtaactggaatttctggctttcattggttttttggtattg  c.597-2761

.         .         .         .         .         .           g.71539
ttggttactgaaactagcattggaaaaacctgttatcttgcttggtgtatagaaaactga  c.597-2701

.         .         .         .         .         .           g.71599
aatccagttaccactattaggtattgccttttaagttagttggtcaccctgcacactctt  c.597-2641

.         .         .         .         .         .           g.71659
agaacttgaacttgtttgcaaggtgactggatgactgacataggcctgagatggcacgtg  c.597-2581

.         .         .         .         .         .           g.71719
aggctaactcttccactagaagtctgtgatattgaggttgtggtacactctgtgggctgc  c.597-2521

.         .         .         .         .         .           g.71779
aagagattgccactgaaagatagccatgtatatattcatttgtcctctcatcagtccttc  c.597-2461

.         .         .         .         .         .           g.71839
tctgtctcagaaattcttttttatttttattttttgagatggagtcttgttctgttgccc  c.597-2401

.         .         .         .         .         .           g.71899
aggatggagtgcagtggcatgatcttggctcactgcaacctctacttcccgagttcaagc  c.597-2341

.         .         .         .         .         .           g.71959
aattctcctgcctcagcctcctgagtagctgggattacaggcatgcaccaccatgcttga  c.597-2281

.         .         .         .         .         .           g.72019
ctaatttttgtatttttagtagagacggggtttcaccttgttggccaggctggtcttgaa  c.597-2221

.         .         .         .         .         .           g.72079
ctcctgacctcagatgatccccacgcctcagcctcccaaagtgctgggattacaggcatg  c.597-2161

.         .         .         .         .         .           g.72139
agccactctcagaaattctatcagtggttttcactttttccccttctgaggtttccctca  c.597-2101

.         .         .         .         .         .           g.72199
aagaaaaagaattttcaaggattgaatgagaaagaaacttgaaaagccaaaaagatggag  c.597-2041

.         .         .         .         .         .           g.72259
agcatgtttaaggtaacagtactaaggtgtttactgactgttatgaaggggcctatgaaa  c.597-1981

.         .         .         .         .         .           g.72319
cattgccatctaacagtggaggtcacatgcctcttgtattctaatcacaacttggtgttc  c.597-1921

.         .         .         .         .         .           g.72379
cttgcctgtggcaataagcccgggtatgacttttctgtctttggagcctgaatgaaatga  c.597-1861

.         .         .         .         .         .           g.72439
atacttactctttgtggtctgattagattttgaaggcatgtggcatgagtccaaatccca  c.597-1801

.         .         .         .         .         .           g.72499
aagttaccttgatgcagtttatttatgaaaacatgctccaactgagcagaattcaaattg  c.597-1741

.         .         .         .         .         .           g.72559
aacaagatctcacttgccagggcagacattttttctcttaagtatatatttggagtgtat  c.597-1681

.         .         .         .         .         .           g.72619
ctgaggatatagtctctcagtccaccccacttatactcacagatctgtgggcaagtattg  c.597-1621

.         .         .         .         .         .           g.72679
agtgggaatgtgacagatattatatggggcttcttttggtgctacctgctaccaagctgt  c.597-1561

.         .         .         .         .         .           g.72739
gttagtatcagctgtgagacaaatgctttgtaatgaagcacatttatcctgtgtctgctt  c.597-1501

.         .         .         .         .         .           g.72799
tctgtcttcttctaatcagaagtgaatttttatagaaatctttcgtggcccaaccagaca  c.597-1441

.         .         .         .         .         .           g.72859
gatgtaattaaaaacagtagaaaaaaatggaaacttactagtatttttcctttttctttt  c.597-1381

.         .         .         .         .         .           g.72919
aaaatttttgtttctttctttttttttttttcttttcgagacagggtctctgttgctcag  c.597-1321

.         .         .         .         .         .           g.72979
gctggagtgtgatcatagttgactgcagccttcaactactaggctcaagcgatcctccca  c.597-1261

.         .         .         .         .         .           g.73039
cctcagccttctgagtagctaggatacaagtgcaccatgcttgactaacttaaaaatttt  c.597-1201

.         .         .         .         .         .           g.73099
tttttaatttgttttaacttttatgttaaactatgttgcccaggatgggctctaactcct  c.597-1141

.         .         .         .         .         .           g.73159
agcctcaagcagtcctcctgcctttgcctcccaaagtgctgggattatagacatgaacta  c.597-1081

.         .         .         .         .         .           g.73219
ctgtgcctagcctactctttttaaaatcactattatttctttgtagtgaaactatgtatt  c.597-1021

.         .         .         .         .         .           g.73279
aggaggtttgtaatttaatagtctagtcttgagctctataaataaataaaaaaccatatg  c.597-961

.         .         .         .         .         .           g.73339
gtattttggtgatttgggtaagtattcctccctcgttagctttgaatcaaataatatgtt  c.597-901

.         .         .         .         .         .           g.73399
gtctaattcattcagggagttcactgagtgctcactgtggtcaggtgcggtgggcagtgc  c.597-841

.         .         .         .         .         .           g.73459
tggcaagacagaggagaaagtatagcacagagagagttatgtatgcaccagattttaatg  c.597-781

.         .         .         .         .         .           g.73519
aatgtggtaaagctgataggtccgtgctttgtactctggtggtcaaggaagtttccattt  c.597-721

.         .         .         .         .         .           g.73579
actctgatgggcaaacctggaaaagttttacagagaagatacccatgagtttggtgttta  c.597-661

.         .         .         .         .         .           g.73639
caagtttgctcagtaaaggttgggtacaggcactctaggcagatgtccattgggagagaa  c.597-601

.         .         .         .         .         .           g.73699
caatggggaggtgtgtgctctgggtgtagcaagtgggtgctgtgatgctagagatggtca  c.597-541

.         .         .         .         .         .           g.73759
ggggaatggtagggccctcaagactggctcaggagtttggggctttattctgtatgggaa  c.597-481

.         .         .         .         .         .           g.73819
aggagccattgaaaatgttcaaacaagacagtgacttgaaataaaacaaaaccacatgct  c.597-421

.         .         .         .         .         .           g.73879
tttcccccataaaacccagcaagattcattaaagtgagaaacaaaaagtggccattgtct  c.597-361

.         .         .         .         .         .           g.73939
ttctcaagcataatttatttccctctttcttttttctttctctgtcattatttagtgtaa  c.597-301

.         .         .         .         .         .           g.73999
agatgataaggagtcaacaaagcttatgacttttttccccaaggcattgtattgtattgt  c.597-241

.         .         .         .         .         .           g.74059
acgttgtttggcagatgttggaataatgaatgctacttttgcaaccaggcttgcattcat  c.597-181

.         .         .         .         .         .           g.74119
ttattggtcagccagccgttgggttttcacagtcctttccctcaaggaatttaaactgtt  c.597-121

.         .         .         .         .         .           g.74179
atttttatctttaaatctgtatgtttatctgttttcaaacactagaaagtctcaagaatg  c.597-61

.         .         .         .         .         .           g.74239
tgttagtcttgcttgacacttcttttggttaaaaaaaatcaaattgtctctattttctag  c.597-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center