beta 3-glucosyltransferase (B3GLCT) - 5231 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.74363
gtatgtcatgttttgtttgattaaaaatcttactaatcaagaattcatgtcctttgatgt  c.660+60

         .         .         .         .         .         .  g.74423
aaaaggtattttgcattccctaatcttgcattttccccacccacatctactccccacaga  c.660+120

         .         .         .         .         .         .  g.74483
gataatttcatagcactccagcgaattaggtgcttttattttaagctcatttcagttatg  c.660+180

         .         .         .         .         .         .  g.74543
tagatgaagacagaacagtgaaaaaggttgcatcttgtgattcatgattctttactttta  c.660+240

         .         .         .         .         .         .  g.74603
agctagatgaatgggtccagaggtagatttctaaaaaaatgcaaaaatgtcattaaaagt  c.660+300

         .         .         .         .         .         .  g.74663
acctctgctcttacttgatgcttcggttgtacgtatgccagtgtagattgaatgatcatg  c.660+360

         .         .         .         .         .         .  g.74723
tccccgcccccctaattcataccttgaaacctgagccccagtgaaatggtctttggaggt  c.660+420

         .         .         .         .         .         .  g.74783
agacctgtgggaggtgataggggcatgagagtggagccctcatcaatgggattagcactt  c.660+480

         .         .         .         .         .         .  g.74843
ttataaaagaggccgcagggggcttccttgccctttctgccatgtgaggatacagctaga  c.660+540

         .         .         .         .         .         .  g.74903
aggtgccatccatgaaccaggaagcaggccctcaccacttaatctgccagtcccttgatc  c.660+600

         .         .         .         .         .         .  g.74963
ttagacttcccagcccctagaactgtgagaaataaatttgttatttagactccactcagt  c.660+660

         .         .         .         .         .         .  g.75023
ctatggtattttactgttggagcctgaacagactaagacgtatgcctttgttgtgtgtct  c.660+720

         .         .         .         .         .         .  g.75083
gtgcttggctgtctggagcagaattgagcctattggtcccaagcaggcagcctggagccc  c.660+780

         .         .         .         .         .         .  g.75143
taacactcctggttccttcacatttactggacatctgtgaccagttattctagaggcagg  c.660+840

         .         .         .         .         .         .  g.75203
tggcagttgtcccatcattaattattctcgaatcatcattaagaaggccctttttgcatt  c.660+900

         .         .         .         .         .         .  g.75263
tcacttgtgggcatgcctgactgcacaaaacagtcttgcctctcattctctgcaggaatc  c.660+960

         .         .         .         .         .         .  g.75323
tgtatgttaggacattaaggtaaatcttgacatgtaattcagtccagcagtgctgatggc  c.660+1020

         .         .         .         .         .         .  g.75383
cttccagggacaagaaggcacacacaagactttctgacttctcagctgtctttaaatggt  c.660+1080

         .         .         .         .         .         .  g.75443
aatacagaatatttgagtagaaataaacttagaaaaacataattcttctcttccacaaag  c.660+1140

         .         .         .         .         .         .  g.75503
atgaaaaaaatggcttgttgaaaaccaagttctgcctagataggattaatgaaaagtcag  c.660+1200

         .         .         .         .         .         .  g.75563
ctctagatacttaggtttggaaatctactaaacattgaatatatacaaaataatatttct  c.660+1260

         .         .         .         .         .         .  g.75623
aacatatatgaaaggtataaagattaatgaacaaaatacttaactagcttgcctggttta  c.660+1320

         .         .         .         .         .         .  g.75683
agaaggagacaactatgagtgaccttgaggctacctatgtgcttcttgaggagaggcctc  c.660+1380

         .         .         .         .         .         .  g.75743
cttccgtctccccacactaaactctcttgaattctctccctctcccttacttttcttcat  c.660+1440

         .         .         .         .         .         .  g.75803
attttattacgtatgaatgtatttctgaataacatgtaattttgcatccttttgggcttt  c.660+1500

         .         .         .         .         .         .  g.75863
atataaacaaaattgtatacaaatgctgcaggattttttgctccttagttcagctaatct  c.660+1560

         .         .         .         .         .         .  g.75923
ggattcttgtctcacaaccaggaagaattaggcacacagacacattgaagggtgaggagg  c.660+1620

         .         .         .         .         .         .  g.75983
atggaatgtatttaagtgaaaggaaagctctcagcaaagagagggggtcctgtcagcagg  c.660+1680

         .         .         .         .         .         .  g.76043
tttccacctcataaaatgaataccagggcccctacacacgagttgaagaggactctcctc  c.660+1740

         .         .         .         .         .         .  g.76103
ccctgcataaggcgtgaattcctggtggctccaccccattcttccagtgcatgtgggcct  c.660+1800

         .         .         .         .         .         .  g.76163
ccatgcatgtgggcctccagtccactgcaggcatgcctaggcaaaccccctgtgcaggtt  c.660+1860

         .         .         .         .         .         .  g.76223
cccatattcggacaaaacatttggtgtaaataaacacttgtggggttgatcagagattct  c.660+1920

         .         .         .         .         .         .  g.76283
ctgggggcccttccctatctgcctaggcatttggctgtctcccacctctatcacaaataa  c.660+1980

         .         .         .         .         .         .  g.76343
ctgttctaatttgagactcatccatgttgattcatgcagctctaattaacttatttttac  c.660+2040

         .         .         .         .         .         .  g.76403
tttctatagtagtctcccatatgaccataataatttatttatccgttctcttgttaatgg  c.660+2100

         .         .         .         .         .         .  g.76463
gcttctgattggctactggttttttgctattacaaccattgcttctatgaatatttttaa  c.660+2160

         .         .         .         .         .         .  g.76523
tgtgtatcatggtgatcatctgcaagagttactccaaggcagaagcttttaaactttttt  c.660+2220

         .         .         .         .         .         .  g.76583
ttgactatgacccactttaaaaaaataaattttcatcatgacccagtatatttgtgtgtg  c.660+2280

         .         .         .         .         .         .  g.76643
tggtggtgtttctgttattgatttctaacagtattattgtagtctatacaacagtcattt  c.660+2340

         .         .         .         .         .         .  g.76703
gagatacttttaggcttactttatggcctagctcatgttcagttttcatatctattagat  c.660+2400

         .         .         .         .         .         .  g.76763
tgaagaaagtattaatgatgcttttcagatattttcttctttacttcattgcttcaatcc  c.660+2460

         .         .         .         .         .         .  g.76823
ttcattttacttttgttttgtctgcttatcatttactaagggaggaatgtagaaatcgtc  c.660+2520

         .         .         .         .         .         .  g.76883
cataataatggtggatttttcctatggaactgccaactcttgctttttatactctaaggc  c.660+2580

         .         .         .        g.76919
tatgttaattagatgcatacaaacttagaattgtta  c.660+2616

--------------------- middle of intron ---------------------
             g.76920          .         .         .           g.76954
             c.661-2615  catcctcttagtgaatttgtctttatctttagtaa  c.661-2581

.         .         .         .         .         .           g.77014
tgctgtttgtcttaatgtttattttgttgacatgaatatttcaatgttagcattttttgg  c.661-2521

.         .         .         .         .         .           g.77074
ttgtttgcctcataatcgttttttgtctttttctttcaatccttttgtgtccttatcttt  c.661-2461

.         .         .         .         .         .           g.77134
tttagatgtgtctcttttaaagaggacatgccttttccccccaccctccagtttgaaaat  c.661-2401

.         .         .         .         .         .           g.77194
ctttatctttaaaccagatagcaaatttacctttatgttgattgtaattactgatatatt  c.661-2341

.         .         .         .         .         .           g.77254
tgacttctatcactttattttgtgcccctctccttattttctatttttcctttttttttt  c.661-2281

.         .         .         .         .         .           g.77314
tttttgagacagagtcttgctgtgtcacccaggctggagtgcagtggcgccatcttggct  c.661-2221

.         .         .         .         .         .           g.77374
tactgcaacctccacatcctgggttcaagcagttcgctgccttagccccctgattagctg  c.661-2161

.         .         .         .         .         .           g.77434
ggattacaggtgcccgccaccatgcccggctaattttttttgtatttttagtagagatgg  c.661-2101

.         .         .         .         .         .           g.77494
ggtttcaccatcttggccaggctggtcttgaattcctgaccttgtgatctgcccaccttg  c.661-2041

.         .         .         .         .         .           g.77554
gcctcccaaagtgctgggattacaggagtgagccaccgtgcccggcccctctatttttct  c.661-1981

.         .         .         .         .         .           g.77614
attttaaagttccttgtcttcttattcatttatttattagtccatattttttcttttctg  c.661-1921

.         .         .         .         .         .           g.77674
ctattttagaagttaaatctgtctgtactttactgattattttaaatatttaacatgctt  c.661-1861

.         .         .         .         .         .           g.77734
tcttaacctaacaatggtttattaatcaatagccagaaaatttgagggccttaggataat  c.661-1801

.         .         .         .         .         .           g.77794
ttaactctgattatcccactcccaacttacatgcacttgttgttcaatatttttgtccct  c.661-1741

.         .         .         .         .         .           g.77854
ttttcttttcaccctggaaacttagatattgtcattattttatgcagttaacatttttat  c.661-1681

.         .         .         .         .         .           g.77914
taactcatcatatatttgccattgtttttgcttatcattccatcttgcttcttaggcctt  c.661-1621

.         .         .         .         .         .           g.77974
ccaattgaatcctttttattcctcctgaagtgtatatcctttagaatttcttttagtgag  c.661-1561

.         .         .         .         .         .           g.78034
gtggtaaattctctcaatattttttctttaacaatatttatttcaactttgtttttgaag  c.661-1501

.         .         .         .         .         .           g.78094
catgcttacatcatgtagatgattctaggttgccagtcattttctgtcatcacaagtttt  c.661-1441

.         .         .         .         .         .           g.78154
attcaattatttttcttttttctttctttgtttttcttttgagacagagtctctctcact  c.661-1381

.         .         .         .         .         .           g.78214
ctgtcacccaggctggaatgcagtggcatgatcttggctcactgcaacctccatctcccg  c.661-1321

.         .         .         .         .         .           g.78274
ggttcaagcaattcttctgcctcagcctcctgagtagctgggactacaggcgcgtgccac  c.661-1261

.         .         .         .         .         .           g.78334
cacgaccagctaatttttgtatttttaagtaaagatggggtttcaccatattggacaggc  c.661-1201

.         .         .         .         .         .           g.78394
tggtctcgaactcctgacctggcgatctgcccgcctcagcctcccaaagtgctgggatta  c.661-1141

.         .         .         .         .         .           g.78454
taggcgtgagccaccacgcccagcctcagttatttttcaaatgtgcttacttgttttgtg  c.661-1081

.         .         .         .         .         .           g.78514
taatcttttcaaaataattttttctcacgttttaaagtttttcttttctttataaaaata  c.661-1021

.         .         .         .         .         .           g.78574
tattaagcatagtaattttataatctgtttgataattctgatagctgaagttttttgagt  c.661-961

.         .         .         .         .         .           g.78634
ctgattaaataaattatgtctgctggctcttgttcgttatcttatttcttttttgtgtgt  c.661-901

.         .         .         .         .         .           g.78694
gatttttttttctctgagtgattgttctgtaagcacccttgttcctttggaaaaatcctc  c.661-841

.         .         .         .         .         .           g.78754
tgagccgtatattaaagtagtggttccttagtaaggatttacattagcttctgcctgttg  c.661-781

.         .         .         .         .         .           g.78814
ctagtgggttatactgacgagataatttaaattatcagtttgagatgttttgggacctca  c.661-721

.         .         .         .         .         .           g.78874
caggtggcacaaattagggaggcctggcttttggttgcaaaatctaagaggagatttaga  c.661-661

.         .         .         .         .         .           g.78934
gattattcttttccctccatttagacccatggtcctagctttatgtagggggattgctgt  c.661-601

.         .         .         .         .         .           g.78994
tggtcacaccccaccttgggtgggtcatagacttcagtctcttcactcctatcagaaact  c.661-541

.         .         .         .         .         .           g.79054
cagccttgccagaggtcagctgatacctactagggaaaactacccttggtgccttttttt  c.661-481

.         .         .         .         .         .           g.79114
ccccaggatctcactttcccatttttgttctcgcagattccacatttttgtgccaactta  c.661-421

.         .         .         .         .         .           g.79174
gcaatacatgtaaatatttaagggcattttacccaacatttgtagatgttttaagcaagt  c.661-361

.         .         .         .         .         .           g.79234
tgagtatttggggtatgtgattaccatactaaggaaactggagccataatattttcttac  c.661-301

.         .         .         .         .         .           g.79294
atctctctctgtgatgttgtagaatgtgttctttcctaaaaccgcatacttcggaatttt  c.661-241

.         .         .         .         .         .           g.79354
ttggaggtcagaatattgattcatagttaattgcttattgttagtaatagattacattta  c.661-181

.         .         .         .         .         .           g.79414
ttcacatggaattgtcatttttttaagtttaggaagtcctgttgaatactgacaaattga  c.661-121

.         .         .         .         .         .           g.79474
tatggttcagcctactctctatggaagatgtgttctgctttcccttgagatattttgtcc  c.661-61

.         .         .         .         .         .           g.79534
cttcttatacttgtgttgactgagttctttcatcactgcctgtctcctgtctcgtggcag  c.661-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center