beta 3-glucosyltransferase (B3GLCT) - 2073 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.79714
gtgagtaacagaagaaaaacttctttgcatatcaaaggaaaaatttagatgctgtgcata  c.780+60

         .         .         .         .         .         .  g.79774
atgtcatcctagcactttaaaatgaattttaaattcagggcattcatgtgcaagttggtt  c.780+120

         .         .         .         .         .         .  g.79834
ataagggtatattgtgtgatgctaaggtttgggcttctgctgattctgtcacccaaatag  c.780+180

         .         .         .         .         .         .  g.79894
tgaacatggtacccaataggaagttttcaaaccttgctcttcttccttcctccccttttt  c.780+240

         .         .         .         .         .         .  g.79954
agagtccccagtgtctgttgttcctatttttatgtttgtgtgtacccagtgtttagcttc  c.780+300

         .         .         .         .         .         .  g.80014
cacttataagtgagaacatgcagtatttggttttctgtttctgcattaattcacgtagga  c.780+360

         .         .         .         .         .         .  g.80074
taatggcccccagctgcatccatgttgctgcaagtacattatttcattctttcttatggc  c.780+420

         .         .         .         .         .         .  g.80134
tgcatagtattccttggtatatctgtaccacattttctttattcagtccaccattaatgg  c.780+480

         .         .         .         .         .         .  g.80194
gcacctacattgattccatgtctttgctattgtgaatagtgctgcactagcactttacat  c.780+540

         .         .         .         .         .         .  g.80254
actaaaaagaaaatcaacattttccctgtgccaagtaagaactatatatcatgactctag  c.780+600

         .         .         .         .         .         .  g.80314
taataacaatcatacaaggtttagtactattgtaactccatcttacaaatgagaagagag  c.780+660

         .         .         .         .         .         .  g.80374
aggcacagagaagccaagtgcttgcttatggctacacagctagtagggagggaagcaagg  c.780+720

         .         .         .         .         .         .  g.80434
gctcccctttactccagagcctttgtgagggactgcccaccatagcgctttagggttagt  c.780+780

         .         .         .         .         .         .  g.80494
gtgcccagactcatttcttttgttgatgatgtaggatgcattgattagaatttctgttcc  c.780+840

         .         .         .         .         .         .  g.80554
atttcctggaaaggcaatttccagtgctttctgtgacacccacgccttctccacaagccc  c.780+900

         .         .         .         .         .         .  g.80614
gcaccctttactctttcagcaggtggctctgcctttcatctcaatgacagccatccagaa  c.780+960

         .         .         .         .         .         .  g.80674
ctttcagaatgaattcacttgttttggcagacccaaggtccagccccagtatgagcctgg  c.780+1020

         .         g.80691
agaccctgacactcaca  c.780+1037

--------------------- middle of intron ---------------------
                                g.80692           .           g.80707
                                c.781-1036  aggttgttaacagctt  c.781-1021

.         .         .         .         .         .           g.80767
ttctcataagaaaaaatgtgttcaccaacctcagatattgtcgttattctcaagtcagtc  c.781-961

.         .         .         .         .         .           g.80827
acacacaagtctgtgtgtgccatttgaagagataaatacatagacacacacacacacgca  c.781-901

.         .         .         .         .         .           g.80887
cacacacacaccccaaaacacagtgcagcattgagagagaatctgtaattgtttgcagtt  c.781-841

.         .         .         .         .         .           g.80947
ccagagggggagaccagtctttctaggcagaatgcttgcttgctctttcagtgctctcct  c.781-781

.         .         .         .         .         .           g.81007
agtgccttgagtgacatgacaaagctgtagttagatgtcactataaaccagccccaaatt  c.781-721

.         .         .         .         .         .           g.81067
atacaggagtcatgattaactatgattgcaggcctaaggcaggtaataaaggggtcatga  c.781-661

.         .         .         .         .         .           g.81127
agggcttgggtgtgtcttgttgacaaatccctctttgtgccccctttcatctgtgtgatc  c.781-601

.         .         .         .         .         .           g.81187
agcctgggctccaggactgcccccaccccatctccaccaggtgtttcaaggaatcctacc  c.781-541

.         .         .         .         .         .           g.81247
tttggcagaggagaaaacatccttagcctagacttgggtcgccagtaaagaggccgtaaa  c.781-481

.         .         .         .         .         .           g.81307
aatgttttcaacattaaagtaaggccaggcccagaaaagggcaacatctcttaatttaca  c.781-421

.         .         .         .         .         .           g.81367
ctaaaaaatcccccctatttctctctttttgtcaaaatcttcaccagctggagaaaggaa  c.781-361

.         .         .         .         .         .           g.81427
atgagaggtaactaacatttattggtcagttactatgtgcttaataaattatagtaataa  c.781-301

.         .         .         .         .         .           g.81487
tagcagccttgcagtggttattatttttttttctaaacaagcagactgaaattctggaaa  c.781-241

.         .         .         .         .         .           g.81547
cttgttaaggggatgcacagtccgtgcacagtgtagcaggcaggtccagggctggctgac  c.781-181

.         .         .         .         .         .           g.81607
agaaaggctatgttgtcagctgacctatgtttccatttctcccctaaaactttatgccgg  c.781-121

.         .         .         .         .         .           g.81667
aaatatgtttggtatccttgacattggttaatttgaactctagagcgtgtgagatctagt  c.781-61

.         .         .         .         .         .           g.81727
gtgggtgtgaagttaacgctgactcacatatgcatacattttttcttttcttttttttag  c.781-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center