beta 3-glucosyltransferase (B3GLCT) - 7876 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.81857
gtatgttttgggttattcattttattgaacgctaaaatccagactaccttctaaagaaaa  c.850+60

         .         .         .         .         .         .  g.81917
gtaccaatgaattcttgagtgtaaattcagaaaagggataatgacaattcggatgttgaa  c.850+120

         .         .         .         .         .         .  g.81977
gtgaaagcagttatttaatcaatactcctcattgcaccatttcaatcaccaagatcaatt  c.850+180

         .         .         .         .         .         .  g.82037
aggaaagaaaattttgtattgaaacgtgagtggtcatagccgatactgcttatggcagta  c.850+240

         .         .         .         .         .         .  g.82097
ttttaaattggaaatggaaaagctcagtgtggcagtcttggagactgtgtgaaaaacagt  c.850+300

         .         .         .         .         .         .  g.82157
ccattttgtcaaacaatgtattaggtctgtgcgcagtctctaaacgggatgaagaatgtc  c.850+360

         .         .         .         .         .         .  g.82217
aggggatttcaaggtaacagcatgccaacaaagaaaaaagactttttcttctttttcaat  c.850+420

         .         .         .         .         .         .  g.82277
ttatttcaaatgcttaccttggaacttgttagttaagagatgtatttgctcatgagtaga  c.850+480

         .         .         .         .         .         .  g.82337
taatattggagaagaagaaaaagccgcggtacaaacagtgaatctcttcttaaggaaatc  c.850+540

         .         .         .         .         .         .  g.82397
ctggcatgcagattaatgttgtttttattcaggtttttgatgtcattacagaattctgct  c.850+600

         .         .         .         .         .         .  g.82457
aagttgtgacgataatgtaaaaaaaaaaagcccatcctaaatataaatagacataatttc  c.850+660

         .         .         .         .         .         .  g.82517
tctctttttgcaccttatttcaagcaacacttttctgaaattgaaaattaggcagtcttt  c.850+720

         .         .         .         .         .         .  g.82577
tgcattttctaattttagtgcgtattttaatttttttccccatgaaaagactgtcaattt  c.850+780

         .         .         .         .         .         .  g.82637
caccaaggatgtggtatttatgtaggagagatttctaaaccaactgtcattttcatggga  c.850+840

         .         .         .         .         .         .  g.82697
ttggaactactgaagaagttcatttatatattttatgtgataatatgatacatacaaatt  c.850+900

         .         .         .         .         .         .  g.82757
atattttacaggggaagatgttttccaaataaaataatattataatttgagattatagta  c.850+960

         .         .         .         .         .         .  g.82817
ttgtctaagacatcaacatcaattaaaatccagctataatcaattatatcttaaaaatac  c.850+1020

         .         .         .         .         .         .  g.82877
attaactataaaccttcatatttgcctaaaatggccacactaaattccaaatcctattaa  c.850+1080

         .         .         .         .         .         .  g.82937
atcagtctatatgaatacatttgttatgcaacaagtcctaagatactgtgaagaatcagt  c.850+1140

         .         .         .         .         .         .  g.82997
atagcagttaaaataaaatttttatttatcataaatttaacctaaatttaatatcctttt  c.850+1200

         .         .         .         .         .         .  g.83057
acttttttcataatatggaagggttttgtgggattattttgacaaataccttctttaaat  c.850+1260

         .         .         .         .         .         .  g.83117
aggtgttggggaaatgaactataccgctttttgttttgtttcttttacagcaagcaggaa  c.850+1320

         .         .         .         .         .         .  g.83177
ctgtttgaattgatttaattgatcttgaagctacacttggagtagtgattgttttcacaa  c.850+1380

         .         .         .         .         .         .  g.83237
tattaatgttaaggatggtgttgctggtactttttctttgaaacacatttttcaggtcac  c.850+1440

         .         .         .         .         .         .  g.83297
agtgaagcagtaaaattagggacactccctgttgtattttttatattctacagaaatgaa  c.850+1500

         .         .         .         .         .         .  g.83357
aaaaaaaatagtttgttaattttgatttagtaattttgaataatctagtttactgctttc  c.850+1560

         .         .         .         .         .         .  g.83417
ttattttgcataagtttgagatactctttttagatattcatgaaatccttttctgtttga  c.850+1620

         .         .         .         .         .         .  g.83477
attttgagtcaaaagtctttaaaaattacaaaatcttaaaagcctattaggagcattaga  c.850+1680

         .         .         .         .         .         .  g.83537
aacaaaccttccaaagccagatgcattgatttactgctgttaatttgaatctgggatcat  c.850+1740

         .         .         .         .         .         .  g.83597
taaagcatgaggcctaaaatgtatcatgaagttttcatatttgggtttctgtggtaagcc  c.850+1800

         .         .         .         .         .         .  g.83657
gtttttcaacttggatatgtttgtttgaaaagatagtctaaggcaacaggatttcagtga  c.850+1860

         .         .         .         .         .         .  g.83717
ctttgaagtccattttgcatgacttcatgtagcctgccaagccaccactgggctctgccc  c.850+1920

         .         .         .         .         .         .  g.83777
ctcattttagaagcctagtccagccatcagttggcccaaagagttatccagtaataccag  c.850+1980

         .         .         .         .         .         .  g.83837
ttacaaggataacatcacactaactgcttctaactgctaatatttcttacattttctggt  c.850+2040

         .         .         .         .         .         .  g.83897
gtgtttttcacatatgttctattacctagtttcatgttgacacttcctcgtgatatgata  c.850+2100

         .         .         .         .         .         .  g.83957
attattgttattcacttgttgtggaaaaagctgagtatggaatgatacacaactggctca  c.850+2160

         .         .         .         .         .         .  g.84017
gtttcttgtatcctattgagtagcagagccaaagacttgggttttctggctcctaagtcc  c.850+2220

         .         .         .         .         .         .  g.84077
cacatttttttctaccacagcacagctatactgtaatctccttggatgtattacaaactc  c.850+2280

         .         .         .         .         .         .  g.84137
catacttgataaatagtctttgctattcatgttgatgtcctgctatgctcaaggtcagtt  c.850+2340

         .         .         .         .         .         .  g.84197
ttgacttggccagaagctgtgaaagtaggctttccatttttagtagcaatggggatggca  c.850+2400

         .         .         .         .         .         .  g.84257
aggaattgaaacccacacaggatctaaaatacaaatcgagctgagaatttagactgccac  c.850+2460

         .         .         .         .         .         .  g.84317
tcctatctaagcatatcactgctatagtcaagcagaatacatggtctggggtgttggatt  c.850+2520

         .         .         .         .         .         .  g.84377
tttttttcattttcttttccctgtgcactctattagtgggggaaaccagcccccaatatt  c.850+2580

         .         .         .         .         .         .  g.84437
caacgtgagtccttttctattttccctaagtgttggccagtctgagaaataaagggaagg  c.850+2640

         .         .         .         .         .         .  g.84497
agtacaaaagagagaaattttaaagctgggtgtccgggggagacatcacatgttggcagg  c.850+2700

         .         .         .         .         .         .  g.84557
ttctgtgatgccccctgagccgtaaaaccagcaagtttttattagtgattttcaaaaggg  c.850+2760

         .         .         .         .         .         .  g.84617
gagggagtgtacgaatagggtgtgggtcacagagatcacttgcttcacaaggtaataaaa  c.850+2820

         .         .         .         .         .         .  g.84677
tagcacaaggcaaatggaggcagggcgagatcacaggaccagggcgaaattaaaattgct  c.850+2880

         .         .         .         .         .         .  g.84737
aatgaagtttcaggcacacattgtcattgataatatcttatcaggggacagggtttgaga  c.850+2940

         .         .         .         .         .         .  g.84797
gcagacaaccagtctgaccaaaatttattacgcaggaatttcctcatactaataaacctg  c.850+3000

         .         .         .         .         .         .  g.84857
ggagcgctacgggagactggggcttatttcatcccttatcaacgaccataaaagacagac  c.850+3060

         .         .         .         .         .         .  g.84917
atttccaaagcggccatttcagagaccgtcccttgggaacgcattctctttctcagggat  c.850+3120

         .         .         .         .         .         .  g.84977
gttccttgctaagaaaaagaattcagcaatatttctcctatttgcttttgagagaagtga  c.850+3180

         .         .         .         .         .         .  g.85037
aatatggctctgttctgcccagcctacaggcagacagactttaagggtatctcccttgtt  c.850+3240

         .         .         .         .         .         .  g.85097
ccctgaatatcgctgttatcctgttcttttttcaaggtgcccagatttcatattgtttaa  c.850+3300

         .         .         .         .         .         .  g.85157
acaatttgtgcagttaacgcaatcatcacagggtcctgaggtgacatttcatcctcagct  c.850+3360

         .         .         .         .         .         .  g.85217
tatgaagatgacgggattaagagattaaagtaaagacaggcataggaaatcacaagagta  c.850+3420

         .         .         .         .         .         .  g.85277
ttgattggggaagtgataagtgtccatgaaatctttacaatttatgttcagagattgcag  c.850+3480

         .         .         .         .         .         .  g.85337
taaagacaggcataagaaattataaaagttttaatttggggaactaataaatgtccatga  c.850+3540

         .         .         .         .         .         .  g.85397
aatctttacaatttatgttctcctgccatggcttcagccggtccctccgtttggggtccc  c.850+3600

         .         .         .         .         .         .  g.85457
tgacttcccgcaacactctgtggtagaaatacttcagtaacaaaggccaaatgatgaagg  c.850+3660

         .         .         .         .         .         .  g.85517
aaaaaaatctagagaaactgtacttgtgtttgccaagttgagagtggggtgtactgttaa  c.850+3720

         .         .         .         .         .         .  g.85577
ttgtgggcacagtgtcccctggcactgggtggtgatggcccccactcctgcttcattata  c.850+3780

         .         .         .         .         .         .  g.85637
tgttggttaccttctgggatgagaaggagagatggaacatgttctgctcaaggccgtagt  c.850+3840

         .         .         .         .         .         .  g.85697
cacagcaagggaaaatatagattgcatttattttttatactctcatggaagaattgataa  c.850+3900

         .         .         .          g.85735
taaaaccaagtttcacaatgaaaagaaatattttaaat  c.850+3938

--------------------- middle of intron ---------------------
          g.85736             .         .         .           g.85773
          c.851-3938  attgtactttcttggcttaacaataacacatttatgta  c.851-3901

.         .         .         .         .         .           g.85833
attgcttttgtctggattctgacttaagtgaaacagcattcttagaacacaacaagcaaa  c.851-3841

.         .         .         .         .         .           g.85893
aatatactctgtcttttggctcaaggaagtaatacatattgacatcattgaaacagcagc  c.851-3781

.         .         .         .         .         .           g.85953
accctctgagaggcaagcatttagtaggattttaaagaaacttgagaactgttacataag  c.851-3721

.         .         .         .         .         .           g.86013
gtgatgaattgggcatagcatgtaaaattatatttaagcaaggaaatgatctctggtgtt  c.851-3661

.         .         .         .         .         .           g.86073
ttaatattcaacttgattgcttcctcttgggttctgtgtttcccactgtgtgacctgagc  c.851-3601

.         .         .         .         .         .           g.86133
tgtcagaaaaccttaagaattttctttgcatcatttttccatgcagtttgtgtacatgtc  c.851-3541

.         .         .         .         .         .           g.86193
tcatgtacctcgtggcagccactggttttgttcatcaaatggtgggttgtgggatgctct  c.851-3481

.         .         .         .         .         .           g.86253
cctgcagtctccctctaattaaagaggttaaattgccgtttgctcagcctttagttcctt  c.851-3421

.         .         .         .         .         .           g.86313
tccacagcttcctaggctcttaaaaattagcactatattcctttcagattaaaaaaaaac  c.851-3361

.         .         .         .         .         .           g.86373
aaaaacaaaaacctgtttgctgtctttactgctgtggtcttgtctagaggcaaatctgaa  c.851-3301

.         .         .         .         .         .           g.86433
caaactgattgaaaggggtgtttggtggctggtgttctctttgactaaagaggcttacat  c.851-3241

.         .         .         .         .         .           g.86493
gtactgtggtacagtctgcttacttaaaaggtgaggcttgaattaaaatacagccagata  c.851-3181

.         .         .         .         .         .           g.86553
gaaggccagactctaatcaaatgaggtgattagatcaatgaatgaagagaggagaggagt  c.851-3121

.         .         .         .         .         .           g.86613
caggtgttgcctttccctggctgttgaatagctgatgttccagattgccctacagtgttg  c.851-3061

.         .         .         .         .         .           g.86673
tgttagggcatccaggagggatacttttcaggcttaggtacacctcagtctttaaaatga  c.851-3001

.         .         .         .         .         .           g.86733
ggaattaggacacattcatgtgtgtgtccctaatctgctcctgagaagagaagtgcaatc  c.851-2941

.         .         .         .         .         .           g.86793
agggtcttattttgtgaccactgacttgcacactgagacaaaagggccatctgcaagctg  c.851-2881

.         .         .         .         .         .           g.86853
aaaatagtggattccttaaaataaaaactattcacatttgatggtgtggtagttttaata  c.851-2821

.         .         .         .         .         .           g.86913
aaatgttcaagtgtcaagttcattttcatttataatctgagacagttttataagtcacct  c.851-2761

.         .         .         .         .         .           g.86973
ccctgggggtaaaaatgcatgttctgtcctcatagtgagacacatcttctgcttagagtc  c.851-2701

.         .         .         .         .         .           g.87033
tagaaagctctaagaaagatttatgccatctgtgcagctggcatttttatagtaaaattt  c.851-2641

.         .         .         .         .         .           g.87093
tttttactttgctccaagtttaagttatctcatgacaaactttcttgaaagaggcattca  c.851-2581

.         .         .         .         .         .           g.87153
ctattattataggaagtatacttctttattgaaaaggagataatgtatcaggtaacttat  c.851-2521

.         .         .         .         .         .           g.87213
taaagtattttctcaaagtttagtatctttaggaatacagtgcctcaatacaatataaaa  c.851-2461

.         .         .         .         .         .           g.87273
tattttgtaaataatagaatgaattcattttagaatttaaatgatgctaataaaatagac  c.851-2401

.         .         .         .         .         .           g.87333
cattattctaaaagtttaactaatttagaatcaaccctggttgaaaataaagccttaagc  c.851-2341

.         .         .         .         .         .           g.87393
tgtttttttggaagactttaaatcctttatggctaagagatgacagacagggccgagtgc  c.851-2281

.         .         .         .         .         .           g.87453
ggtggctcatgcctgtaatcccagcactttgggaggccgaggcgggcggatcacgaggtc  c.851-2221

.         .         .         .         .         .           g.87513
aggaaatcaagaccatcctggctaacacggtgaaaccctgtctctactaaaaaatacaaa  c.851-2161

.         .         .         .         .         .           g.87573
aaaaattagccgggcgtggtggcgggcgcctgtagtcccagctactcaggaggctgaagc  c.851-2101

.         .         .         .         .         .           g.87633
aggagcatggtgtgaacccaggaggcagagcttgcagtgagctgagatcacaccactgca  c.851-2041

.         .         .         .         .         .           g.87693
ctccagcctgggcaacagagcgagagagtgagactctgtctcaaaaaaaaaaaaaaaaat  c.851-1981

.         .         .         .         .         .           g.87753
gacagatgcatggaggttatattgacaaggggagagatgtacaaactgttgaatgcttta  c.851-1921

.         .         .         .         .         .           g.87813
ggtattgtagaatcataatatcttagtatatctaaatggttggcttgttttaaaatgatt  c.851-1861

.         .         .         .         .         .           g.87873
aatcaaaggctgaattgcctttatgaataaaaccttcctttaacaagcttccacaaataa  c.851-1801

.         .         .         .         .         .           g.87933
tcctaggccttttattgaaatgcctacaaaattcagtcctcattcaactgtttattgagt  c.851-1741

.         .         .         .         .         .           g.87993
gtctactatgtcctaggcactgtgccaggtgttgggaaatgagtcatacacacactaatt  c.851-1681

.         .         .         .         .         .           g.88053
cttacctttagtgtaatttctattttacctgtttcaaagtaaaagagaaagcaaaagtgc  c.851-1621

.         .         .         .         .         .           g.88113
taactcacccttgattttgattttaattttatttaactcagttaattgagaagaaacacc  c.851-1561

.         .         .         .         .         .           g.88173
cgtgttctttaataaacctattagagcgaaaaaggactgaaagcctaaaggctgaggaaa  c.851-1501

.         .         .         .         .         .           g.88233
ttgaaagcaaaatttgcacagcctgcaggacccttgctggggactgaggaaagttcttga  c.851-1441

.         .         .         .         .         .           g.88293
cctttcctcacagcttcttccagcattatgcaatggaggatattttacccaacagtgtga  c.851-1381

.         .         .         .         .         .           g.88353
acttttagtggctgcaagctgcagggagccctttctggggtaagttctcttgcttattgt  c.851-1321

.         .         .         .         .         .           g.88413
atgcaaagcaaactgccacagcagtgccaaggttaacatttttgttgtgctgaaatttgg  c.851-1261

.         .         .         .         .         .           g.88473
aagtagaacagagtgaaattttttaacatttcttttttcctttttttgtccgccagtagc  c.851-1201

.         .         .         .         .         .           g.88533
cctattatttagtacatctttgaccattttgacatgtagaaacctttagaactatctgct  c.851-1141

.         .         .         .         .         .           g.88593
tttttatggttgcagaaaaattatattttaatatatgaaattaatatttaactggtaatt  c.851-1081

.         .         .         .         .         .           g.88653
tggtaattttagcagatgtgcagaactcagtttttttaaaaaaaaagccagtgaaagaga  c.851-1021

.         .         .         .         .         .           g.88713
ttataaaatgatgcacttctgtattttctatataagggctgtctgagctggactcagaat  c.851-961

.         .         .         .         .         .           g.88773
ttgcttacttattagctaaacacttaaattttacattggaacatcagtttttgtatatat  c.851-901

.         .         .         .         .         .           g.88833
ttctattagagttgggaacaggggaaagatacatgatctgataaagtttctcaaaagtta  c.851-841

.         .         .         .         .         .           g.88893
agtgaagatttggttcatcagagttttgacaggatataaaatctaaatgttttttctatt  c.851-781

.         .         .         .         .         .           g.88953
gaaaaaacaagaaaccactttttaaaattcagagatgcataggcagtaatttgtttttta  c.851-721

.         .         .         .         .         .           g.89013
agtatagaagaaaagaattacttggtcaggtgaattaatatcaagtagtggtaagtctat  c.851-661

.         .         .         .         .         .           g.89073
atgtcaggtatgcagacagagctatctttgagcctccaaagccaaaatacagaaaaccag  c.851-601

.         .         .         .         .         .           g.89133
gacagctttctgttgtgtttattgtgttaaaacaatttagctgctaatgatagagtttta  c.851-541

.         .         .         .         .         .           g.89193
aagcctgcagtagttttgaatgttagtacttccacatttttcaaaagtacaacatcgtaa  c.851-481

.         .         .         .         .         .           g.89253
tatcagtcatcatatgcagtgattctcatttggcaaggtcatgccctttgtagggttggg  c.851-421

.         .         .         .         .         .           g.89313
tagttctgttagaatctttgggtggggacatgcatagtttgcaaaggtcttctcatgctc  c.851-361

.         .         .         .         .         .           g.89373
cacggtaagagggatggattttctcttaccgtgctccgtggtaaaagaaaaattagttaa  c.851-301

.         .         .         .         .         .           g.89433
cattaatgtaaacacaatagcataatcaaaccagaaaatttatcattatatggaagtaag  c.851-241

.         .         .         .         .         .           g.89493
tgcattcatcaccaggaatgagaaatgctttactctagagaatgttgaaaatgcttcaag  c.851-181

.         .         .         .         .         .           g.89553
aagagggttttagtcaacaacgttggcatttctcagggttggaagcaagcaactcttgga  c.851-121

.         .         .         .         .         .           g.89613
acacctgaagaacaaccagtaatgtttctcttcctttgtagatgattatactgccatttt  c.851-61

.         .         .         .         .         .           g.89673
gaatttttaagcttccttgtgtaactgtgccagtgattgtcacctctgtaattttttcag  c.851-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center