beta 3-glucosyltransferase (B3GLCT) - 1958 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.89847
gtgagtcataattcttactactctccttattaaacattgccattctgtaaatacagtaaa  c.964+60

         .         .         .         .         .         .  g.89907
ttaggttaggataaaaatgaaatgttttataagtgctataatttttgcctcatattagtt  c.964+120

         .         .         .         .         .         .  g.89967
ttttcccttctctcagatactgattggttctttcaaactaagggctttatagtacgaagt  c.964+180

         .         .         .         .         .         .  g.90027
gttgcaagtttttagtagcttatatcctataattgagcacatgatagttacagcagaatt  c.964+240

         .         .         .         .         .         .  g.90087
taacaatagatttttcataccttcataattctttgcgaccatgatggggtgtttattata  c.964+300

         .         .         .         .         .         .  g.90147
ttcccacataaagcttctctccttgtcagtcttatagtctagttcacatattatattacc  c.964+360

         .         .         .         .         .         .  g.90207
cgtgagtaccacctaatcacattctacactagttatatgtagaataaactgtattctata  c.964+420

         .         .         .         .         .         .  g.90267
tgttaagattttaattagtaaattgttggaaataaacctgcttttctcttcaaattgcag  c.964+480

         .         .         .         .         .         .  g.90327
gctttctaattaaaaacactttttaggacatacagagtggaatggtagacattggagact  c.964+540

         .         .         .         .         .         .  g.90387
ccaaaaggtgggagagtagaagaggggcgagggatgagaaattacccactgagtacgata  c.964+600

         .         .         .         .         .         .  g.90447
gacactcttcgggtgatggcttcaccaaaagcccagacttcaccactgtacaatatgtcg  c.964+660

         .         .         .         .         .         .  g.90507
atgttacaaaactgcacttgtacctcttaaatctataaaaattttaaaaaattgtgtcaa  c.964+720

         .         .         .         .         .         .  g.90567
aaaatggaagtgaaaatttggccacctcatcttcagatattctttattcatcttaagttt  c.964+780

         .         .         .         .         .         .  g.90627
tatccagtgttcctgccaccctttgttctttagtttttttgttccccatgcccttttatg  c.964+840

         .         .         .         .         .         .  g.90687
agtaaaaaaaaaaaaaaaaaaaaaaaaaagtagcaaactgattatgttctatacagtaat  c.964+900

         .         .         .         .         .         .  g.90747
ttatcttattttatgttagtgtcactcataattctttcattaatatagtacaatgcagaa  c.964+960

         .           g.90766
tcagatatgccatctctgt  c.964+979

--------------------- middle of intron ---------------------
                              g.90767             .           g.90785
                              c.965-979  agttaccaattcttctaac  c.965-961

.         .         .         .         .         .           g.90845
aaggttaagtgtattactgagtctgtctgttgctgtttgatttggaaaaacgattttaga  c.965-901

.         .         .         .         .         .           g.90905
ttgggtttaataatcatgtatttacttataccttatttgatgtcttcattactagtctgg  c.965-841

.         .         .         .         .         .           g.90965
tcttattgtctatatttatatttgttctaaaagggatttgaggtggctttgaaacacgta  c.965-781

.         .         .         .         .         .           g.91025
ttgtaatggttaaaaatacacagagatcaagagtaaagaaaataaaggtcaaattgagtg  c.965-721

.         .         .         .         .         .           g.91085
gtttaatagtcattaatataagttaatatttgtgctccactgtgtcaccaaataattaaa  c.965-661

.         .         .         .         .         .           g.91145
atgaggggcatattcctgtttatcaatttgactactcttcccaagtgttttatttttgtc  c.965-601

.         .         .         .         .         .           g.91205
cagcatttaccattaaagcattgtaatttatctattggtatctgaaggactgttactctg  c.965-541

.         .         .         .         .         .           g.91265
tcttactcagcactatatctttagtgcttagtacctgccacagtatctggcatgttagaa  c.965-481

.         .         .         .         .         .           g.91325
acttagtggtagtaaatatttacaaaataagtaaatgaaggtataagcttccgcctttgc  c.965-421

.         .         .         .         .         .           g.91385
actgctgcttccctgtggcagtggtgcctggggttctaacagctccttcagaataagttt  c.965-361

.         .         .         .         .         .           g.91445
atctaagaaaggatgccattgctcattgctgtgagtcttaaaactttcttgcctggactg  c.965-301

.         .         .         .         .         .           g.91505
aagttactaattctatctctgcctcagattatctgtgtgactgtgtaattccactcatct  c.965-241

.         .         .         .         .         .           g.91565
ctctaggtctccatttccttgtgtgagaaatgaatggcttgaatttcattatctctaaag  c.965-181

.         .         .         .         .         .           g.91625
ttcccactggttcaatgtgtctgtgaaaattagagaaggctatttttaaaaattttgaac  c.965-121

.         .         .         .         .         .           g.91685
ttttaagctgcattttggcatgtaagctcttagaacacttcaaaactaaaaagaaatgaa  c.965-61

.         .         .         .         .         .           g.91745
caaattctatatattttataagaaataatacattgtaagtttttttcttgccttttctag  c.965-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center