beta 3-glucosyltransferase (B3GLCT) - 30746 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.91905
gtaaggagtcattctcatcctaaatggctttaaattctacatatattcatattcaaaaaa  c.1064+60

         .         .         .         .         .         .  g.91965
ctagatgggtactttttctggccaagatgaagtaacggggacggggtttacccttctatc  c.1064+120

         .         .         .         .         .         .  g.92025
tgaaccaatcctcttaaggaacaaaatatataaaacaaaggtttttaacacactgaatat  c.1064+180

         .         .         .         .         .         .  g.92085
taggtgcaaaggaaaatgatccaaaagaaacatgaagcaaatgaggtgagttctatgact  c.1064+240

         .         .         .         .         .         .  g.92145
gccagagctgactgccttaagagaattccaagttactgcttagggagggagcaccagatg  c.1064+300

         .         .         .         .         .         .  g.92205
gaacctgacagactctgtgggcggaaaagatggagctgagagtctcaggagaccaaggct  c.1064+360

         .         .         .         .         .         .  g.92265
attacagtttgcaggacagagtaccagagaggagagagctatacagaaagggaacactgg  c.1064+420

         .         .         .         .         .         .  g.92325
aggtaggtgaagagcccccttatgtattcaatagagtattgatcagtgcatatgtgtgag  c.1064+480

         .         .         .         .         .         .  g.92385
gaaactacccgatgctggggaaagacccaaccagattagagggaattgtgcctgacactc  c.1064+540

         .         .         .         .         .         .  g.92445
acacatgcctgggctggaaaacccctgttcacaaggtattgagaacagcgtgtaagaggg  c.1064+600

         .         .         .         .         .         .  g.92505
tcttgcctcaataggggggatagttaaccctagactaagcacttttccagtcctgcctaa  c.1064+660

         .         .         .         .         .         .  g.92565
catatctgaaaagcaagaaaatacaagaaaatgaaactgtttccaagtagtagcctgtgt  c.1064+720

         .         .         .         .         .         .  g.92625
ctgagaacaaaactcaagaagacttacagaaatacaaaaataaccaacatctaataaagt  c.1064+780

         .         .         .         .         .         .  g.92685
aaaattcataatatctgccatccaatcaaaagttgccaggcatataaagcagcaggaaaa  c.1064+840

         .         .         .         .         .         .  g.92745
tacagaagtgaaaaaaaattagcttattgaaatggtttcagaatttatacaaggttagaa  c.1064+900

         .         .         .         .         .         .  g.92805
ttagaagttattaagctgttactattaaatagttattatacctctattccatatgttcaa  c.1064+960

         .         .         .         .         .         .  g.92865
aaagacatggaatgtctcttagtcttaaataagtttaaatcatacctctagagatgaaaa  c.1064+1020

         .         .         .         .         .         .  g.92925
ctacattcttgattgaggtgaaaaacccactggatgggtttaatagcaaattcatttaag  c.1064+1080

         .         .         .         .         .         .  g.92985
aagaaagtatcagtgaactcgaagacattgcaataataactatccaaactgaaacacaaa  c.1064+1140

         .         .         .         .         .         .  g.93045
gataaaaaataattttagaaaattaacaccatcactgagctgtgggacaatttcaggtgg  c.1064+1200

         .         .         .         .         .         .  g.93105
ccttgaatatatgcaattgaaatctccaaagagaaggagcacataattatttaaagaaat  c.1064+1260

         .         .         .         .         .         .  g.93165
atttttcaaatttaatgaaaactgtaaacccatagatccaagagtgtcaatgaaccccag  c.1064+1320

         .         .         .         .         .         .  g.93225
gcacaccataagcacaaaagcagagaacagccacctccaggaatgccataatggacactt  c.1064+1380

         .         .         .         .         .         .  g.93285
aggacagtacccactgccccactctaggcagctgtggaattgaggactagcatgcttaac  c.1064+1440

         .         .         .         .         .         .  g.93345
ccattgtagctacccacaacaccaacatggacctcttgggtctcagtgggttgctccacc  c.1064+1500

         .         .         .         .         .         .  g.93405
accactactgccatcattcacatcataccagctgctcagggggctaacaacttgtccaca  c.1064+1560

         .         .         .         .         .         .  g.93465
cacctagcccactgctctcattactagcttctaagcaagcagttcacctgcaggcccaag  c.1064+1620

         .         .         .         .         .         .  g.93525
aatcagccattcagaactctctaacaccacagccagcataagctgctttagggcctaaaa  c.1064+1680

         .         .         .         .         .         .  g.93585
acaggcatattcacccttctgctgccaccactggggcccaaagactgactcagttggcat  c.1064+1740

         .         .         .         .         .         .  g.93645
ccaagtccccagcaaaatttcacagcttcagctaataaccataccctaagccactgagga  c.1064+1800

         .         .         .         .         .         .  g.93705
aattacacataccacgaaccttgtgtactactgaaaaagtcacacaaagaccacactaca  c.1064+1860

         .         .         .         .         .         .  g.93765
acagcaccaaaaataaaagccaaggtgtcttacttaaccaacaacatatatacatcttca  c.1064+1920

         .         .         .         .         .         .  g.93825
ggaaaaatattctcccctacaaaagcaatttttaaaaattggaacaacaataccagatat  c.1064+1980

         .         .         .         .         .         .  g.93885
gcagatatcaatggaaggaaacaggaaacatgaaaaagcaagaaaatatgataccagtaa  c.1064+2040

         .         .         .         .         .         .  g.93945
aggaccacaacaattttctgggaacagatcccaatcagtaagaattcctgaaataacaga  c.1064+2100

         .         .         .         .         .         .  g.94005
taaagaattcaaaatattgattttaaagaacctcattgaggtacaagagaaatctgaaaa  c.1064+2160

         .         .         .         .         .         .  g.94065
ccagtacaaaaataagaaaatgaattcaagatgtgaatgagagatataccaaggaaatag  c.1064+2220

         .         .         .         .         .         .  g.94125
atatctttaatttaaaaaaccaaacagattctggaactgaaaattcattgaaggaaatac  c.1064+2280

         .         .         .         .         .         .  g.94185
aaaatacatttgaaagctttggtaatagactagaccaagcagaaggaggaatttcaaaac  c.1064+2340

         .         .         .         .         .         .  g.94245
ttgacgacagatcttttgaaataattcagccacacaaaaataaggaaaaaatgaaaaaga  c.1064+2400

         .         .         .         .         .         .  g.94305
atgaaaacagccctcaagatgtctaggactatacaaaatgaccaaacttataaattatca  c.1064+2460

         .         .         .         .         .         .  g.94365
atatttttgagggggaagagagatcaaaaactttagaaatcctactgaaggacataattg  c.1064+2520

         .         .         .         .         .         .  g.94425
atgaaaatgtcccaaatgtagcaaaagagttagatatttagatacaggagatccagtgat  c.1064+2580

         .         .         .         .         .         .  g.94485
cttcatgtaaatacattgaaaaaaggacttcacatggcatattaggacttcacatggcat  c.1064+2640

         .         .         .         .         .         .  g.94545
attatattcagaatgtttaaattcaagtgaaagaaagaatctttaaaattagcaagagca  c.1064+2700

         .         .         .         .         .         .  g.94605
aaagcatcaagtcatgtataaaggactaatagtggacttttcagcagaaaccttataggc  c.1064+2760

         .         .         .         .         .         .  g.94665
caaagagaatgagatggcactttagccatcgtgctaaaagaaaaaaaaaaagctgtgagc  c.1064+2820

         .         .         .         .         .         .  g.94725
caagaattttatatcctgccagaataagccttatagataaaggggaaataatctttccca  c.1064+2880

         .         .         .         .         .         .  g.94785
gacaaggaaatgctgaggaaatttgtcaccactaggtagggacaaagcctcacatatcaa  c.1064+2940

         .         .         .         .         .         .  g.94845
gattaaccttgaatataactggattaaatgcttcacttaaaagatacagattgccagaat  c.1064+3000

         .         .         .         .         .         .  g.94905
ggattttttttattgttttatctgacattttccaataacattggtagtttttttttttta  c.1064+3060

         .         .         .         .         .         .  g.94965
attatactttaagttctggggtacatatgcaaaatgtgcaggtttgttacataggtatac  c.1064+3120

         .         .         .         .         .         .  g.95025
acgtgccatggtggtttgctgcactcatcaacccatcatctacattaggtatttctccta  c.1064+3180

         .         .         .         .         .         .  g.95085
atgctacccctcccctagccaccccaccttccaacaggccctggtgtgtgatgttcccct  c.1064+3240

         .         .         .         .         .         .  g.95145
ccctgtgtccaggtgttctccttgttcaactcccacttatgactgagaacatgtggcgtt  c.1064+3300

         .         .         .         .         .         .  g.95205
tggttttctgttcctgtattagtttgctgagaatgatggtttccagattcatccatgtcc  c.1064+3360

         .         .         .         .         .         .  g.95265
gtgcagaagatgaactcatgcttttttatggctgcatagtattccatggtgtttatgtgc  c.1064+3420

         .         .         .         .         .         .  g.95325
cacattttctttatccagtctgtcaccgatgggcatttgggttggttccaagtctttgct  c.1064+3480

         .         .         .         .         .         .  g.95385
attgtgaatagtgctgcagtaaacatgtgtgcatgtgtctttacagtggaatgacttata  c.1064+3540

         .         .         .         .         .         .  g.95445
atcctttggatatatacccaataatgggattgctaggtcaaatggtatttctagttctag  c.1064+3600

         .         .         .         .         .         .  g.95505
atccttgagggatcgccacactgtcttccacaatggttgaactaatttacactcccacca  c.1064+3660

         .         .         .         .         .         .  g.95565
gcagtgtaaaagtgttcctatttttccacatcctctccagcatctgttgtttcctgactt  c.1064+3720

         .         .         .         .         .         .  g.95625
ttaatgattgccattctaactggcgtgagatggtatctcattgtggttttgatttgcatt  c.1064+3780

         .         .         .         .         .         .  g.95685
tctgtaatgaccagtgatgagctttttttcatatgtttgttggccacataaatgtcttct  c.1064+3840

         .         .         .         .         .         .  g.95745
tttgagaagcgtctgttcatatcctttgtccactttttgatggggttgtttgtatttttc  c.1064+3900

         .         .         .         .         .         .  g.95805
ttgtaaatttgtttaagttctttgtagattctggatattagctctttgtcagatggatag  c.1064+3960

         .         .         .         .         .         .  g.95865
attgcaaaaattttctcccattctgtaggttgcctgttcactctgatgatagtttctttt  c.1064+4020

         .         .         .         .         .         .  g.95925
gctgtgcagtagctctttagtttaattggatcctgtttgtcaattttggcttttgttgcc  c.1064+4080

         .         .         .         .         .         .  g.95985
gttgcctttgaggttttagtcacgaagtctttgcccatgcctatgtcctgaatggtattg  c.1064+4140

         .         .         .         .         .         .  g.96045
cctaggtgttcttctagactctttatggttttaggtcttacatgtaactctttaatccat  c.1064+4200

         .         .         .         .         .         .  g.96105
tttaatttttgtataaggtgtaagaaaggttttctgcatatggctagccagttttctcaa  c.1064+4260

         .         .         .         .         .         .  g.96165
caccacttattaaatagagaatcctttccccattgcttgttttcgtcaggtttgtcaaag  c.1064+4320

         .         .         .         .         .         .  g.96225
atctgatggttgtagatgtgtggcattatttctgaggcctctgttctattccattggtct  c.1064+4380

         .         .         .         .         .         .  g.96285
gtatatctgttttggtaccagtaccatgctgttttggttactgtggccttgtagtatagt  c.1064+4440

         .         .         .         .         .         .  g.96345
ttgaagtcaggtagcctgatgcctccagctttgttctttttgctttggattgtctttttt  c.1064+4500

         .         .         .         .         .         .  g.96405
tgttccatatgaaatttaaaatagttttttctaattctgtgaagaaagtcaatggtagct  c.1064+4560

         .         .         .         .         .         .  g.96465
tgatggggattgcattgaatctgtaaattactttggtcagtatggccgttttcacaatac  c.1064+4620

         .         .         .         .         .         .  g.96525
tgattcttcctatccatgaccatggaatgttttttcatttgtttgtgtcctctcatttcc  c.1064+4680

         .         .         .         .         .         .  g.96585
tgagcagtggtttgtagttctccttgaagaggtctttcagatcccttgtaagttggattc  c.1064+4740

         .         .         .         .         .         .  g.96645
ctaggtattttattcttgttgtagcaattgtgaatggcagttcactcgtgatttgcttct  c.1064+4800

         .         .         .         .         .         .  g.96705
ctattattggtgtataggaatgcttgtgattttcgcacattgattttgtatcctgagact  c.1064+4860

         .         .         .         .         .         .  g.96765
ttgctgaagttgcttatcagcttaaggagattttgggctgagatgatggattttctaaat  c.1064+4920

         .         .         .         .         .         .  g.96825
atatgatcatgtcatctgcaaacagagacaatctgacttcctctcttcctatttgaatat  c.1064+4980

         .         .         .         .         .         .  g.96885
ccattatttctttctcttccttattgccctggccagaacttccaatactgtgttgaatag  c.1064+5040

         .         .         .         .         .         .  g.96945
gagtggtgagagagggcatccttgtcttctgccagttttcaaagggaatgcttccagttt  c.1064+5100

         .         .         .         .         .         .  g.97005
ttgcccattcagtatgatattggctgtgggtttgtcataaatagctcttattattttgag  c.1064+5160

         .         .         .         .         .         .  g.97065
atacatttcatcaatacctagtttattgggtgtttttagcatgaaggggtgttgaatttt  c.1064+5220

         .         .         .         .         .         .  g.97125
atcgaaggcctttttgcatctattgagataatcatgtggtttttgtcattggttctgttt  c.1064+5280

         .         .         .         .         .         .  g.97185
atgtaatggattacatttattgttttgcatgtgttgaacccgtcctgcatcccaggtatg  c.1064+5340

         .         .         .         .         .         .  g.97245
aagctgacttgatcatggtagacaaggtttttgatgtgctgctggatttggtttgccagt  c.1064+5400

         .         .         .         .         .         .  g.97305
attttactgaggattttcacatcaacgttcatcagggatattggtctgaaattttttttc  c.1064+5460

         .         .         .         .         .         .  g.97365
ttgtgtctctgccaggttttagtatcagaatgaggctggccttataaaatgagttaggga  c.1064+5520

         .         .         .         .         .         .  g.97425
ggattccctctctttttattgtttggaatagtttcagaaggagtggtaccagctcctctt  c.1064+5580

         .         .         .         .         .         .  g.97485
tgtatctctagtggaattcggctgtgagtctgtctggttctgggctttgtttggttggta  c.1064+5640

         .         .         .         .         .         .  g.97545
ggctattaattattgcctcaatttcagaacttgttattggtctattcagggattttacct  c.1064+5700

         .         .         .         .         .         .  g.97605
cttcctggtttagtcttgggagggtgtaggtgtccaggaatttatccatttcttctagat  c.1064+5760

         .         .         .         .         .         .  g.97665
tttctagtttatttgtgtagaggtgtttatagtattatctgatggtagtttgtatttctg  c.1064+5820

         .         .         .         .         .         .  g.97725
tgggatcagtggttatatcccctttatcattttttatagtttctattttattcttctctc  c.1064+5880

         .         .         .         .         .         .  g.97785
ttttttttttctttattagtctagctagcagtcaattttgttaatcttttcaaaaaacca  c.1064+5940

         .         .         .         .         .         .  g.97845
gctcctggattcattgattttttagagtttttttgtgtctctgtctccttcagttctgct  c.1064+6000

         .         .         .         .         .         .  g.97905
ctgatcttagttatttcttgtcttctgctagcttttgactttgtctgctctttcttctct  c.1064+6060

         .         .         .         .         .         .  g.97965
agttcttttaattgtgatgttaggatgttaattttagatctttctcaccctctcctgtgg  c.1064+6120

         .         .         .         .         .         .  g.98025
gcatttagtgctataaatttcccgctaaacactgctttagctgtgtcccagaggttctgg  c.1064+6180

         .         .         .         .         .         .  g.98085
tacattgtgtgtttgttctcattggttccaaagaacttatttctgcctaaatttcattac  c.1064+6240

         .         .         .         .         .         .  g.98145
ttacccatagtcattcaggagcacattgttcagtttccatgcagttttgcggttttgagt  c.1064+6300

         .         .         .         .         .         .  g.98205
gagtttcttaaatcctaagttctaatttgatttcactgtagtctgagagactgttatgat  c.1064+6360

         .         .         .         .         .         .  g.98265
ttctgttcttttacatttgctgaggagtgttttacttccaattatgtggtcagttttaga  c.1064+6420

         .         .         .         .         .         .  g.98325
ataagtgtgatgtggtgctgtgaagaatgtatattctgttgatttggggtggagagttct  c.1064+6480

         .         .         .         .         .         .  g.98385
gtagatgtctattaggtctgcttggtccagagctgagttcaagtcctgaatatccttgtt  c.1064+6540

         .         .         .         .         .         .  g.98445
aattttctgtctcgttgatctgtctaatattgacagtggggtgttaaagcctcccactat  c.1064+6600

         .         .         .         .         .         .  g.98505
tattgtgtgggagtctaagtctctttgtaggtctttaagaacttgctttatgaatctgga  c.1064+6660

         .         .         .         .         .         .  g.98565
tgctccggtattgggtgcatatatatttaggatagttagctcttctttttgcattgatcc  c.1064+6720

         .         .         .         .         .         .  g.98625
ctttaccattatgtaatgcccttctttgtcttttttgatctttgttggtttaaagatctg  c.1064+6780

         .         .         .         .         .         .  g.98685
ttttatcagatagtaggattgcaacccttgctctctttttttgctttccattttcttgat  c.1064+6840

         .         .         .         .         .         .  g.98745
aaatcttcctccattcctttattttgagcctatgggtgtctttgcacatgagatgagtct  c.1064+6900

         .         .         .         .         .         .  g.98805
cctgaatacagcactccaatgggtcttgactcttttatccaatttgccagtctgtgtctt  c.1064+6960

         .         .         .         .         .         .  g.98865
ttaaatggagcatttagcccatttacatttaaggttaatattgttatgtgtgaatttgat  c.1064+7020

         .         .         .         .         .         .  g.98925
tctgtcattatgatgctagctggttattttgccagttagttgatgcagtttcttcatagt  c.1064+7080

         .         .         .         .         .         .  g.98985
gtcgaaggtctttacaatttgatatgtttttgcagtggctggtaccgctttttcctttcc  c.1064+7140

         .         .         .         .         .         .  g.99045
atatttagtgcttccttcaggagctcttgtaaggaaggccttgtggtggcaaaatctctc  c.1064+7200

         .         .         .         .         .         .  g.99105
agcatttgcttgtttgtaaaggattttatttctctttcgcttatgaagtttagtttggct  c.1064+7260

         .         .         .         .         .         .  g.99165
ggatatgaaattctgggttgaaaattcttttctttaagaatgttgaatattggcacccat  c.1064+7320

         .         .         .         .         .         .  g.99225
tctcttcttgtggcttatagggtttctgctgggagatccgctgtttgtctgatggacttc  c.1064+7380

         .         .         .         .         .         .  g.99285
cctttgtgggtgacccgacgtttctctctggctgcctttaacattttttccttcatttca  c.1064+7440

         .         .         .         .         .         .  g.99345
accttggtgaatctgacgattatgtgtcttagggttgctcttcctgatgagtatctttgt  c.1064+7500

         .         .         .         .         .         .  g.99405
ggtgttctctgtatttcctgagtttgaatgttagcttgtcttgctaggttggggaagttc  c.1064+7560

         .         .         .         .         .         .  g.99465
tcttggataatatcctgaagagtgttttccaacttggttccattctccccatcactttca  c.1064+7620

         .         .         .         .         .         .  g.99525
ggtacagcaatcaaacgtagatttggtcttttcacatagtcccatatttcttggaggctt  c.1064+7680

         .         .         .         .         .         .  g.99585
tgttcatttttcattcttttttctctaatcttgtcttcacactttatttcagtaagttgg  c.1064+7740

         .         .         .         .         .         .  g.99645
tcttcaatccttgctatcctttcttccacttgatcgattaggctgttgatacttgtgtgt  c.1064+7800

         .         .         .         .         .         .  g.99705
gcttcacaaagttctcatgctgtgtttttcagctccatcaggttatttctgttcttctct  c.1064+7860

         .         .         .         .         .         .  g.99765
aaactggttattctagttagcaattcgtctaaccttttttcaaggttcttagcttccttg  c.1064+7920

         .         .         .         .         .         .  g.99825
cattggattagaacatgctcctttaactcggaggagtttgttattacccaccttctgaag  c.1064+7980

         .         .         .         .         .         .  g.99885
tctacttctgtcagttcgtcatactcattctctgtccagttttgttcccttgctggtgaa  c.1064+8040

         .         .         .         .         .         .  g.99945
gagttgttatccttgggagaagaggcattctggttttttttttggaattttcagccattt  c.1064+8100

         .         .         .         .         .         .  g.100005
tgcactggtttttcctcatcttcgtggatttatccacctttggtctttgatgttggtgac  c.1064+8160

         .         .         .         .         .         .  g.100065
ctttgaatggggttttgtgtggacgtcctttttttttgatgctgatgctattcctttctg  c.1064+8220

         .         .         .         .         .         .  g.100125
tttgttagttatccttctaacagtcaggcctctctactgtaggtctgctcgagtttgctg  c.1064+8280

         .         .         .         .         .         .  g.100185
gacgttcactccagaccccatctgcctgggtattaccagtggaggctgcagaacagcaaa  c.1064+8340

         .         .         .         .         .         .  g.100245
gattgctgccttttccttcctttggaagctttgtcccagacgggcacgcgccagatgtca  c.1064+8400

         .         .         .         .         .         .  g.100305
gctggagctctgctgtatgaggagtctgtcggcccctcctgggaggtgtctcccagtcag  c.1064+8460

         .         .         .         .         .         .  g.100365
gaggcacagggttcagggacccacttgaggagggagtctgtcccttagcagagctccagt  c.1064+8520

         .         .         .         .         .         .  g.100425
gctgtgctgggagatccactgctctcttcagagccggcaggcatgaacgtttaagtctgc  c.1064+8580

         .         .         .         .         .         .  g.100485
tgaagctgtgcccactgccaccccttcccccaggtgctctgtcccagggaggtgggagtt  c.1064+8640

         .         .         .         .         .         .  g.100545
ttatgtataagcccctgactgggcatctgcctttcatttagagatcccctgcccagagag  c.1064+8700

         .         .         .         .         .         .  g.100605
gaggaatctagagaggcagtctggctacagcagctttgcctagctgtggtggcctccacc  c.1064+8760

         .         .         .         .         .         .  g.100665
cagttagaacttttagacagctttgtttatactctgaggggaaaactgcctactcaagcc  c.1064+8820

         .         .         .         .         .         .  g.100725
tcagtaatggcagatgcccctccccccaccaagctcgagcatcccagggggacttcagac  c.1064+8880

         .         .         .         .         .         .  g.100785
tgctgtgctggcagcgaggatttccagccagtggatcttagcttgctgggctccgtgggg  c.1064+8940

         .         .         .         .         .         .  g.100845
gtggggttcgctgagctagactacttggctcccttgctttaaccccctttccaggggagt  c.1064+9000

         .         .         .         .         .         .  g.100905
gaacagttctgtctcactggcattccaggcaccactggggtataaaaaaactcctgcagc  c.1064+9060

         .         .         .         .         .         .  g.100965
tatctcaatgtctgcccaaatggctgcccagttttgtgtgtgaaacccagggacctggtg  c.1064+9120

         .         .         .         .         .         .  g.101025
gtataggtacctgagggaatatcctggtctgcaggttgtgaagaccgtgggacaagtgta  c.1064+9180

         .         .         .         .         .         .  g.101085
ggatctgggctggaatgcaccattcctcatagcacagtccctcttgacttctcttggcta  c.1064+9240

         .         .         .         .         .         .  g.101145
ggtgagggagttccccgtccccttgtgcttcccaggtaaggcgacgcacccactgtttct  c.1064+9300

         .         .         .         .         .         .  g.101205
gctcgccctctgtgggctccacccactgtccaaccagtcccaatgagatgcaccaggtac  c.1064+9360

         .         .         .         .         .         .  g.101265
ctcagttggaaatgcagaaatcacctgccttctgcattgatctcactgggagctgcagac  c.1064+9420

         .         .         .         .         .         .  g.101325
cggagctgttcctatttggccatcttgccagccatctcctgttttgttttgttttgtttg  c.1064+9480

         .         .         .         .         .         .  g.101385
ataattatttctcatagttctggagggctagaagcctgagatcagggtgccagcatggtt  c.1064+9540

         .         .         .         .         .         .  g.101445
gggttctagtgagggctctcttgggttgcaggctgctgacttcttgtatcttcaaatggt  c.1064+9600

         .         .         .         .         .         .  g.101505
ggaaagagagcaagctagctctgtggcctcttctcagaagggcatgaatcccatttatga  c.1064+9660

         .         .         .         .         .         .  g.101565
ggtctccaccctcgtgatctcttcaccctcccaaaaggtcccacctctaaatagcttcat  c.1064+9720

         .         .         .         .         .         .  g.101625
attggggattagatttcaacatatgataaaatttggggggaacacaaacattcatttcat  c.1064+9780

         .         .         .         .         .         .  g.101685
aacagctactagtcttctcttagtatagattatcaaatactaagaaaaagaagggtctat  c.1064+9840

         .         .         .         .         .         .  g.101745
ttttcaatagagatgatggagaaatactgtaaaattatgtaacattttttttttatcacc  c.1064+9900

         .         .         .         .         .         .  g.101805
atctggttcatccaccatatgtttctttttccttttttttttaattgtggtaaagtacac  c.1064+9960

         .         .         .         .         .         .  g.101865
acaacttcaaatttaccatcataaccatttttaagtatacagtttagtagtattaaatac  c.1064+10020

         .         .         .         .         .         .  g.101925
atgcataatgttgtgcagccatctgcataactcttttcatcttgtaaaactgaacctcta  c.1064+10080

         .         .         .         .         .         .  g.101985
tatccattaaaaaataactctctatactcccctaaccccatcccctggcaaccatcattc  c.1064+10140

         .         .         .         .         .         .  g.102045
tattttctgcctctatgattttgactactctcagtacctcatataaatggaatcatacag  c.1064+10200

         .         .         .         .         .         .  g.102105
tacttgttttttttttttgtgacttgcttattttacttagcataatgtcttcgaaattta  c.1064+10260

         .         .         .         .         .         .  g.102165
tccgtgttgtagcatattgcagaatttccttcctatttaaggctgaataacattccttgg  c.1064+10320

         .         .         .         .         .         .  g.102225
atacagtatggatagaccatattttgcttatccattcatctgttgatggacactccatca  c.1064+10380

         .         .         .         .         .         .  g.102285
acatggggttgtgggtatgcacccagaaattgaatgactagatcatatggtaattctatt  c.1064+10440

         .         .         .         .         .         .  g.102345
tataatggaaccatcacactgttttcccatagaggttgttccattttacattcctaccag  c.1064+10500

         .         .         .         .         .         .  g.102405
aagtgcacaaggtttccagtttctccacatccttgtcaaccccattattttctgggtttt  c.1064+10560

         .         .         .         .         .         .  g.102465
tttttttttttttttgatagtcgctattctagtgggtgtgaattttgatttgcatttccc  c.1064+10620

         .         .         .         .         .         .  g.102525
taatgattagttggttaggaaaaaactgagctattttcccctctgttctcacactgcaat  c.1064+10680

         .         .         .         .         .         .  g.102585
aatcatcaacacagaagacaacttccgtgaccaaaagtgtggagcagggagagttctcct  c.1064+10740

         .         .         .         .         .         .  g.102645
acccaccaagcaatcaatcagttctgcagtggacaccaaatgggtgtcctttaattcaat  c.1064+10800

         .         .         .         .         .         .  g.102705
tttaacactgtctacctggagatagtgccaattcccacagtttgagggctcagtccccaa  c.1064+10860

         .         .         .         .         .         .  g.102765
gactgccctaccaccccatacaccagacaccagtcattaagtccaggcgtccagaacttc  c.1064+10920

         .         .         .         .         .         .  g.102825
tgactgatgagcttcacgtcggggttcttacaacctcctctgtgggtttatttaatttgc  c.1064+10980

         .         .         .         .         .         .  g.102885
tagagtggctctcagaactcagggaaatactttctcacatttaccagtttattataaagg  c.1064+11040

         .         .         .         .         .         .  g.102945
atattacaaagatacagatgaagagatgtgtagggtgaggtatgagagaaggggtgtgga  c.1064+11100

         .         .         .         .         .         .  g.103005
gcttccatgccctccaggaactccacatgttcagatattctaaagctctctgaagcctgc  c.1064+11160

         .         .         .         .         .         .  g.103065
tctcttggggtttatgaaggcttcattatatagccacgattgattaaaccattggccact  c.1064+11220

         .         .         .         .         .         .  g.103125
gatgatcaacttgactttcagctgctttcccctcccaggagattggggggtgggactgaa  c.1064+11280

         .         .         .         .         .         .  g.103185
agtcccaactctctaatcatgcctttgcctttctggtgaccagtcccatcttgaagctgt  c.1064+11340

         .         .         .         .         .         .  g.103245
cggtatacgttagcctacaaaaagatagcaatttggacgttccaaagattttaggattgg  c.1064+11400

         .         .         .         .         .         .  g.103305
tatgtcagcaaatgggtgatgaaaaccaaatatatatttcataatatcacagcctaccct  c.1064+11460

         .         .         .         .         .         .  g.103365
cgttcttcagataccttacatcaaaagaacatacaactcaaaagatattgccacattaga  c.1064+11520

         .         .         .         .         .         .  g.103425
gtctcattccatcattaataactagtctagtccactatattgtattaatgtttcccagag  c.1064+11580

         .         .         .         .         .         .  g.103485
tgagtccactcaggtttgcaggcttcccttcaatcttgtcaggttccaaagctggagcgg  c.1064+11640

         .         .         .         .         .         .  g.103545
tcttggcaaacaaatagctttacctttttagatatctgttataattgagctgagagacaa  c.1064+11700

         .         .         .         .         .         .  g.103605
tgtcatctgtttctctaagggtctttcaaggtgttaatgtaatgttggatttccctcaat  c.1064+11760

         .         .         .         .         .         .  g.103665
ttataacccattattcattcctttaccctcaactactatttctctttctctccgttaata  c.1064+11820

         .         .         .         .         .         .  g.103725
cccaaatgtttccacctttggaagagacatcagaatcactaccgttctggtttagactgc  c.1064+11880

         .         .         .         .         .         .  g.103785
aggcaacaatgctagtctagcaggtaccttctcctcagcctactcccatgcagatagggt  c.1064+11940

         .         .         .         .         .         .  g.103845
aaagttatgtaggtgcaaagctagtgggttatttttaccaccaggcaatatagctgcatt  c.1064+12000

         .         .         .         .         .         .  g.103905
cactcttagccccagctttgctaagcggggtgaaggagcaacacagtcacatcaggccct  c.1064+12060

         .         .         .         .         .         .  g.103965
aaggaattttgacataagctttaaaaacatagttatggttttttgcttagaaatcagccc  c.1064+12120

         .         .         .         .         .         .  g.104025
tgcttccagcactggcagttgcaggcctggtcctagggccactacgtcaagtaggaggga  c.1064+12180

         .         .         .         .         .         .  g.104085
aagaaaaggttttagtgatctgatttagggaagaaagaaaaaatgatcattattccaacg  c.1064+12240

         .         .         .         .         .         .  g.104145
tactcctgccttggcaagatttgcatagtcacccgagcatcctcttcaccccttcttctc  c.1064+12300

         .         .         .         .         .         .  g.104205
cagaccagccttagaaaaacaggaacatctagtgggcagactcctttagtcccactcatg  c.1064+12360

         .         .         .         .         .         .  g.104265
ttgagtatgagcacacactcttgaaggcatgtaagccagccttttatgtttccagtgttt  c.1064+12420

         .         .         .         .         .         .  g.104325
taattacctgttctattcatctatcaaactatgactctgaggagactatctctgtgccca  c.1064+12480

         .         .         .         .         .         .  g.104385
ttgttggacatcataggctgtacagtgtgttccttggtctgaagaaatgacgattggcca  c.1064+12540

         .         .         .         .         .         .  g.104445
tacaaatccatgcaatatcttctgtttagttgtttttttaatggtactcagagtatttgc  c.1064+12600

         .         .         .         .         .         .  g.104505
atgttccactgagtaagcaaaagccatgccagagtcattgtctattcctgtcaagaccca  c.1064+12660

         .         .         .         .         .         .  g.104565
tttgtagccccatagggccactagcaccagtctctgtattgccagctttgtttaggacct  c.1064+12720

         .         .         .         .         .         .  g.104625
ttgcaccagggaatctgccccatagccattatcagtctctgcctttttttctggtggaga  c.1064+12780

         .         .         .         .         .         .  g.104685
gaacagttcttattggcattttgtgcctgagaggatgcaaaaggaacatgtctagattca  c.1064+12840

         .         .         .         .         .         .  g.104745
gcccatctctgcctgctgccgtacccccatatccactaatttcatggatccaggtgacca  c.1064+12900

         .         .         .         .         .         .  g.104805
cctcaaggaagtccacagggatacctgcttgtcaattccattcaccttccaaacctggaa  c.1064+12960

         .         .         .         .         .         .  g.104865
aggggctcttctgattgacattgacttgttctactttaatgcacccctcaaatgtccatg  c.1064+13020

         .         .         .         .         .         .  g.104925
gggccatgcttcatatgggcatccttttaataggccaagtatccattgccctcttgccta  c.1064+13080

         .         .         .         .         .         .  g.104985
actgtatgggcaggcaattggtcactgcctatgagttagtaaaatcctaaacacaagtgt  c.1064+13140

         .         .         .         .         .         .  g.105045
ttctaccactgttcaattcttccattactgttaggaaaatgcatccaatacagcccactg  c.1064+13200

         .         .         .         .         .         .  g.105105
agattatttgtttttacctcctttggtcaaaatagcagacttccaaacaggatggtattc  c.1064+13260

         .         .         .         .         .         .  g.105165
atttaccctggtattgaattgccatcctcaaaccaagtagctcttggttggtcagtcaag  c.1064+13320

         .         .         .         .         .         .  g.105225
agctgcttacagggtagtgtagaatccagtggctcctcacatagttccagagtcagtttt  c.1064+13380

         .         .         .         .         .         .  g.105285
aggggaaaagagtccctctgtttgtgaggatctcctccttgcattccccaggtagcacga  c.1064+13440

         .         .         .         .         .         .  g.105345
tcatgtataaattctgtttgataatggaatgggcattgcctcccttactaaagtgttcct  c.1064+13500

         .         .         .         .         .         .  g.105405
ctgacatcacccaaaacagcatgggcatttcagatataaatgtaattgcccgatgtgttc  c.1064+13560

         .         .         .         .         .         .  g.105465
ttcctgcctgctgcacagataaaaccagttcattaagactgtaatattgcagtaaagagt  c.1064+13620

         .         .         .         .         .         .  g.105525
ttaattaatgcaagactggccaagtggaaggactggagttattacttaaagtagtctcac  c.1064+13680

         .         .         .         .         .         .  g.105585
tgagaactcagagactagggttttttggataattgggtgggcagggggctagggaatggt  c.1064+13740

         .         .         .         .         .         .  g.105645
tactgctgatgggttgggaatgaagtcctagggatgtggaaaccggtccttgtacaatga  c.1064+13800

         .         .         .         .         .         .  g.105705
atctggctttggttggggaccacaggactggttgagtcatgagtcatgggtctgagtggg  c.1064+13860

         .         .         .         .         .         .  g.105765
ttcagttggttaccagaaggcaaaaatctgaaaaacatctcaaaagaccaatcttaggtt  c.1064+13920

         .         .         .         .         .         .  g.105825
ctacaatagtaacgttatctataggagcaattggggaagtgtcaaatcttgtgacctctg  c.1064+13980

         .         .         .         .         .         .  g.105885
tccacatgattcttgagcagtaagggatgataaaaaatacactttagcaaagttcaggcc  c.1064+14040

         .         .         .         .         .         .  g.105945
cctcccctgatcctaatcttgtggtctttcattagtttttggtccctgagcaaggaggag  c.1064+14100

         .         .         .         .         .         .  g.106005
attagttttagggagagactgttagcatccttccttccaagttaaactataaactaaatt  c.1064+14160

         .         .         .         .         .         .  g.106065
cctgccatgattagcttgacctacgcccaggaatgagtgaagacagccagcctgtgagac  c.1064+14220

         .         .         .         .         .         .  g.106125
tagaagcaagatggagtcagccaagctaaatttctctcactgtcataatctttgcaaagg  c.1064+14280

         .         .         .         .         .         .  g.106185
gggtttcatcaagatcactttatgtcctttagtcataggagtagcctcagttaatgtcct  c.1064+14340

         .         .         .         .         .         .  g.106245
gtagcaaggaagtaaatgcccttcaagtggaaattctctagttcaaagtcctagtagtca  c.1064+14400

         .         .         .         .         .         .  g.106305
ttgctgggaggcactcacaaacctttgccataagccccaggaggtactctgcagaggggg  c.1064+14460

         .         .         .         .         .         .  g.106365
ctatcaaatggggaagttgtccccaccagctcttcagtttctgttctgcactatgtgggc  c.1064+14520

         .         .         .         .         .         .  g.106425
ctgggcagtcttaactggttccaattttagcaagttccattaatactgctcaaaggattt  c.1064+14580

         .         .         .         .         .         .  g.106485
acatatcttctgttttacagtactggatagggggaacatttcccagtcagataaaatgtc  c.1064+14640

         .         .         .         .         .         .  g.106545
tcttcccataatgcagtcaggtaaaagagataaaaccatttcacatgaagtatgttcaaa  c.1064+14700

         .         .         .         .         .         .  g.106605
tatggcagctttcataatcctaacaaccgttacacttttatgttctagtcccaggaattt  c.1064+14760

         .         .         .         .         .         .  g.106665
ccccttttcatccccagatcattttaccctttcttctgcaaaaggctttgggtccccagc  c.1064+14820

         .         .         .         .         .         .  g.106725
ctggagtcccaccaggagaccctggcctctctcttaattgttaccttgattaaccagtct  c.1064+14880

         .         .         .         .         .         .  g.106785
aacaggtaattatagatggggtttctcattttaatctttatcttcttgtctttaaaagtt  c.1064+14940

         .         .         .         .         .         .  g.106845
ctccaaactgggggaaatgcagcaaactggtttgggcccttaaatgttgagagatcagcc  c.1064+15000

         .         .         .         .         .         .  g.106905
aggggtccctttcctccactcagtctttaataatgttgtattaagacttttgttttaacc  c.1064+15060

         .         .         .         .         .         .  g.106965
ccatcaatttctactttattcattccattttttaataaccacctaaatatgtccaccctc  c.1064+15120

         .         .         .         .         .         .  g.107025
ctggggtgagtcccatggctctcccctttctttttcctcttactttcattcctatgaatg  c.1064+15180

         .         .         .         .         .         .  g.107085
ttttctgtattcatcttatttcttacaaaccatttaaaaatttccacctcccaggatgag  c.1064+15240

         .         .         .         .         .         .  g.107145
tcctttgactctcccctctccccttcatcattttcttgttaattaacctaatgtctttat  c.1064+15300

         .         .         .         .         .         .  g.107205
tagcatctgtaagacctcaaggtaaagcttagaccacaaatttgataaggcttctggaac  c.1064+15360

         .     g.107218
tgtcttggttttg  c.1064+15373

--------------------- middle of intron ---------------------
                                 g.107219         .           g.107231
                                 c.1065-15373  cagcagtaagttt  c.1065-15361

.         .         .         .         .         .           g.107291
atatgaggtgcctatgcaaaatgggcccctttaacaacaacatgtaccatggcctggata  c.1065-15301

.         .         .         .         .         .           g.107351
acggtcatattcagtgggtgaatatcccagttatcataaagctagtcccggggaggagcc  c.1065-15241

.         .         .         .         .         .           g.107411
aagatggccgaataggaacagctccggtctacagctcccagcgtgagcgacgcagaagac  c.1065-15181

.         .         .         .         .         .           g.107471
gggtgatttctgcatttccatctgaggtaccgggttcatctcactagggagtgccagaca  c.1065-15121

.         .         .         .         .         .           g.107531
gtgggcgcaggccagtgtgtgtgcgcaccgtgcgcgagccgaagcagggcgaggcattgc  c.1065-15061

.         .         .         .         .         .           g.107591
ctcacctgggaagcgcaaggggtcagggagttccctttccgagtcaaagaaaggggtgac  c.1065-15001

.         .         .         .         .         .           g.107651
ggacgcacctggaaaatcgggtcactcccacccgaatattgcgcttttcagaccggctta  c.1065-14941

.         .         .         .         .         .           g.107711
agaaacggcgcaccacgagacgatatcccacacctggctcagagggtcctacgcccacgg  c.1065-14881

.         .         .         .         .         .           g.107771
aatctcgctgattgctagcacagcagtctgagatcaaactgcaaggcggcaacggggctg  c.1065-14821

.         .         .         .         .         .           g.107831
ggggaggggcgcccgccattgcccaggcttgcttaggtaaacaaagcagccgggaagctc  c.1065-14761

.         .         .         .         .         .           g.107891
gaactgggtggagcccaccacagctcaaggaggcctgcctgcctctgtaggctccacctc  c.1065-14701

.         .         .         .         .         .           g.107951
tgggggcagggcacagacaaacaaaaagacagcagtaacctctgcagacttaagtgtccc  c.1065-14641

.         .         .         .         .         .           g.108011
tgtctgacagctttgaagagagcagtggttctcccagcactcagctggagatctgagaac  c.1065-14581

.         .         .         .         .         .           g.108071
gggcagactgcctcctcaagtgggtccctgacccctgacccccgagcagcctaactggga  c.1065-14521

.         .         .         .         .         .           g.108131
ggcaccccccagcaggggcacactgacacctcacatggcagggtattccaacagacctgc  c.1065-14461

.         .         .         .         .         .           g.108191
agctgagggtcctgtctgttagaaggaaaactaacaaccagaaaggacatctacaccgaa  c.1065-14401

.         .         .         .         .         .           g.108251
aacccatctgtacatcaccatcatcaaagaccaaaagtagataaaaccacaaagatgggg  c.1065-14341

.         .         .         .         .         .           g.108311
aaaaaacagaacagaaaaactggaaactctaaaacgcagagtgcctctcctcctccaaag  c.1065-14281

.         .         .         .         .         .           g.108371
gaacgcagttcctcaccagcaacagaacaaagctggatggagaatgattttgacgagctg  c.1065-14221

.         .         .         .         .         .           g.108431
agagaagaaggcttcagacgatcaaattactctgagctacgggaggacattcaaaccaaa  c.1065-14161

.         .         .         .         .         .           g.108491
ggcaaagaagttgaaaactttgaaaaaaatttagaagaatgtataactagaataaccaat  c.1065-14101

.         .         .         .         .         .           g.108551
acagagaagtgcttaaaggagctgatggagctgaaaaccaaggctcgagaactacgtgaa  c.1065-14041

.         .         .         .         .         .           g.108611
gaatgcagaagcctcaggagccgatgcgatcaactggaagaaagggtatcagcaatggaa  c.1065-13981

.         .         .         .         .         .           g.108671
gatgaaatgaatgaaatgaagcgagaagggaagtttagagaaaaaagaataaaaagaaat  c.1065-13921

.         .         .         .         .         .           g.108731
gagcaaagcctccaagaaatatgggactatgtgaaaagaccaaatctacgtctgattggt  c.1065-13861

.         .         .         .         .         .           g.108791
gtacctgaaagtgatgtggagaatggaaccaagttggaaaacactctgcaggatattatc  c.1065-13801

.         .         .         .         .         .           g.108851
caggagaacttccccaatctagcaaggcaggccaacgttcagattcaggaaatacagaga  c.1065-13741

.         .         .         .         .         .           g.108911
acgccacaaagatactcctcgagaagagcaactccaagacacataattgtcagattcacc  c.1065-13681

.         .         .         .         .         .           g.108971
aaagttgaaatgaaggaaaaaatgttaagggcagccagagagaaaggtcgggttaccctc  c.1065-13621

.         .         .         .         .         .           g.109031
aaaggaaagcccatcagactaacagcggatctctcggcagaaaccctacaagccagaaga  c.1065-13561

.         .         .         .         .         .           g.109091
gagtgggggccaatattgaacattcttaaagaaaagaattttcaacccagaatttcatat  c.1065-13501

.         .         .         .         .         .           g.109151
ccagccaaactaagcttcataagtgaaggagaaataaaatactttatagacaagcaaatg  c.1065-13441

.         .         .         .         .         .           g.109211
ctgagagattttgtcgccaccaggcctgccctaaaagagctcctgaaggaagcgctaaac  c.1065-13381

.         .         .         .         .         .           g.109271
atggaaaggaacaaccggtaccagccgctgcaaaatcatgccaaaatgtaaagaccatcg  c.1065-13321

.         .         .         .         .         .           g.109331
agactaggaagaaactgcatcaactaatgagcaaaatcaccagctaacatcataatgaca  c.1065-13261

.         .         .         .         .         .           g.109391
ggatcaaattcacacataacaatattaactttaaatataaattgactaaattctgcaatt  c.1065-13201

.         .         .         .         .         .           g.109451
aaaagacacagactggcaagttggataaagagtcaagacccatcagtgtgctgtattcag  c.1065-13141

.         .         .         .         .         .           g.109511
gaaacctatctcacgtgcagagacacacataggctcaaaataaaaggatggaggaagatc  c.1065-13081

.         .         .         .         .         .           g.109571
taccaagccaatggaaaacaaaaaaaggcaggggttgcaatcctagtctctgataaaaca  c.1065-13021

.         .         .         .         .         .           g.109631
gactttaaaccaacaaagatcaaaagagacaaagaaggccattacctaatggtaaaggga  c.1065-12961

.         .         .         .         .         .           g.109691
tcaattcaacaagaggagctaactatcctaaatatttatgcacccaatacaggagcaccc  c.1065-12901

.         .         .         .         .         .           g.109751
agattcataaagcaagtcctcagtgacctacaaagagacttagactcccacacattaata  c.1065-12841

.         .         .         .         .         .           g.109811
atgggagactttaacaccccactgtcaacattagacagatcaacgagacagaaagtcaac  c.1065-12781

.         .         .         .         .         .           g.109871
aaggatacccaggaattgaactcagctctgcaccaagcagacctaatagacatctacaga  c.1065-12721

.         .         .         .         .         .           g.109931
actctccaccccaaatcaacagaatatacatttttttcagcaccacaccacacctattcc  c.1065-12661

.         .         .         .         .         .           g.109991
aaaattgaccacatagttggaagtaaagctctcctcagcaaatgtaaaagaacagaaatt  c.1065-12601

.         .         .         .         .         .           g.110051
ataacaaactatctctcagaccacagtgcaatcaaactagaactcaggattaagaatctc  c.1065-12541

.         .         .         .         .         .           g.110111
actcaaagctgctcaactacatggaaactgaacaacctgctcctgaatgactactgggta  c.1065-12481

.         .         .         .         .         .           g.110171
cataacgaaatgaaggcagaaataaagatgttctttgaaaccaacgagaacaaagacacc  c.1065-12421

.         .         .         .         .         .           g.110231
acataccagaatctctgggacgcattcaaagcagtgtgtagagggaaatttatagcacta  c.1065-12361

.         .         .         .         .         .           g.110291
aatgcctacaagagaaagcaggaaagatccaaaattgacaccctaacatcacaattaaaa  c.1065-12301

.         .         .         .         .         .           g.110351
gaactagaaaagcaagagcaaacacattcaaaagctagcagaaggcaagaaataactaaa  c.1065-12241

.         .         .         .         .         .           g.110411
atcagagcagaatggaaggaaatagagacacaaaaaacccttcaaaaaatcaatgaatcc  c.1065-12181

.         .         .         .         .         .           g.110471
aggagctggttttttgaaaggatcaacaaaattgatagaccgctagcaagactaataaag  c.1065-12121

.         .         .         .         .         .           g.110531
aaaaaaagagagaagaatcaaatagacacaataaaaaatgataaaggggatatcaccacc  c.1065-12061

.         .         .         .         .         .           g.110591
gatcccacagaaatacaaactaccatcagagaatactacaaacacctctatgcaaataaa  c.1065-12001

.         .         .         .         .         .           g.110651
ctagaaaatctagaagaaatggatacattcctcgacacatacactctcccaagactaaac  c.1065-11941

.         .         .         .         .         .           g.110711
caggaagaagttgaatctctgaatagaccaataacaggctctgaaattgtggcaataatc  c.1065-11881

.         .         .         .         .         .           g.110771
aatagtttaccaaccaaaaagagtccaggaccagatggattcacagccgaattctaccag  c.1065-11821

.         .         .         .         .         .           g.110831
aggtacaaggaggaactggtaccattccttctgaaactattccaatcaatagaaaaagag  c.1065-11761

.         .         .         .         .         .           g.110891
ggaatcctccctaactcattttatgaggccagcatcattctgataccaaagccgggcaga  c.1065-11701

.         .         .         .         .         .           g.110951
gacacaaccaaaaaagagaattttagaccaatatccttgatgaacattgatgcaaaaatc  c.1065-11641

.         .         .         .         .         .           g.111011
ctcaataaaatactggcaaaccgaatccagcagcacatcaaaaagcttatccaccatgat  c.1065-11581

.         .         .         .         .         .           g.111071
caagtgggcttcatccctgggatgcaaggctggttcaatatacgcaaatcaataaatgta  c.1065-11521

.         .         .         .         .         .           g.111131
atccagcatataaacagagccaaagacaaaaaccacatgattatctcaatagatgcagaa  c.1065-11461

.         .         .         .         .         .           g.111191
aaagcctttgacaaaattcaacaacccttcatgctaaaaactctcaataaattaggtatt  c.1065-11401

.         .         .         .         .         .           g.111251
gatgggacgtatttcaaaataataagagctatctatgacaaacccacagccaatatcata  c.1065-11341

.         .         .         .         .         .           g.111311
ctgaatgggcaaaaactggaagcattccctttgaaaactggcacaagacagggatgccct  c.1065-11281

.         .         .         .         .         .           g.111371
ctctcaccgctcctattcaacatactgttggaagttctggccagggcaatcaggcaggag  c.1065-11221

.         .         .         .         .         .           g.111431
aaggaaataaagggtattcaattaggaaaagaggaagtcaaattgtccctgtttgcagac  c.1065-11161

.         .         .         .         .         .           g.111491
gacatgattgtttatctagaaaaccccatcgtctcagcccaaaatctccttaagctgata  c.1065-11101

.         .         .         .         .         .           g.111551
agcaacttcagcgaagtctcaggatacaaaatcaatgtacaaaaatcacaagcattctta  c.1065-11041

.         .         .         .         .         .           g.111611
tacaccaacaacagacaaacagagagccaaatcatgagtgaactcccattcacaattact  c.1065-10981

.         .         .         .         .         .           g.111671
tcaaagagaataaaatacctaggaatccaacttacaagggatgtgaaggacctcttcaag  c.1065-10921

.         .         .         .         .         .           g.111731
gagaactacaaaccactgctcaaggaaataaaagaggacataaacaaatggaagaacatt  c.1065-10861

.         .         .         .         .         .           g.111791
ccatgctcatgggtaggaagaatcaatatcgtgaaaatggccatactgcccaaggtaatt  c.1065-10801

.         .         .         .         .         .           g.111851
tacagattcaatgccatccccatcaagctaccaatgactttcttcacagaattggaaaaa  c.1065-10741

.         .         .         .         .         .           g.111911
actactttaaagttcatatggaaccaaaaaagggcccgcatcgccaagtcaatcctaagc  c.1065-10681

.         .         .         .         .         .           g.111971
caaaagaacaaagctggaggcatcacactacctgacttcaaactatactacaaggctaca  c.1065-10621

.         .         .         .         .         .           g.112031
gtaaccaaaacagcatggtactggtaccaaaacagagatatagatcaatggaacagaaca  c.1065-10561

.         .         .         .         .         .           g.112091
gagccctcagaaataatgccgcatatctacaactatctgatctttgacaaacctgagaaa  c.1065-10501

.         .         .         .         .         .           g.112151
aacaagcaatggggaaaggattccctatttaacaaatggtgctgggaaaactggctagcc  c.1065-10441

.         .         .         .         .         .           g.112211
atatgtagaaagctgaaactggatcccttccttacaccttatacaaaaatcaattcaaga  c.1065-10381

.         .         .         .         .         .           g.112271
tggattaaagatttaaacgttagacctaaaaccataaaaaccctagaagaaaacctaggc  c.1065-10321

.         .         .         .         .         .           g.112331
attaccattcaggacataggcgtgggcaaggacttcatgtccaaaacaccaaaagcaatg  c.1065-10261

.         .         .         .         .         .           g.112391
gcaacaaaagccaaaattgacaaatgggatctaattaaactcaagagcttctgcacagca  c.1065-10201

.         .         .         .         .         .           g.112451
aaagaaactaccatcagagtgaacaggcaacctacaacatgggagaaaattttcgcaacc  c.1065-10141

.         .         .         .         .         .           g.112511
tactcatctgacaaagggctaatatccagaatctacaatgaactcaaacaaatttacaag  c.1065-10081

.         .         .         .         .         .           g.112571
aaaaaaacaaacaaccccatcaaaaagtgggcgaaggacatgaacagacacttctcaaaa  c.1065-10021

.         .         .         .         .         .           g.112631
gaagacatttatgcagccaaaaaacacatgaagaaatgctcatcatcactggccatcaga  c.1065-9961

.         .         .         .         .         .           g.112691
gaaatgcaaatcaaaaccactatgagatatcatctcacaccagttagaatggcaatcatt  c.1065-9901

.         .         .         .         .         .           g.112751
aaaaagtcaggaaacaacaggtgctggagaggatgtggagaaataggaacacttttacac  c.1065-9841

.         .         .         .         .         .           g.112811
tgttggtgggactgtaaactagttcaaccattgtggaagtcagtgtggcgattcctcagg  c.1065-9781

.         .         .         .         .         .           g.112871
gatctagaactagaaataccatttgacccagccatcccattactgggtatatacccaaag  c.1065-9721

.         .         .         .         .         .           g.112931
gactataaatcatgctgctatgaagacacatgcacacgtatgtttattgcggcactattc  c.1065-9661

.         .         .         .         .         .           g.112991
acaatagcaaagacttggaaccaacccaaatgtccaacaatgatagactggattaagaaa  c.1065-9601

.         .         .         .         .         .           g.113051
atgtggcacatatacaccatggaatactatgcagccataaaaaatgatgagttcatgtcc  c.1065-9541

.         .         .         .         .         .           g.113111
tttgtagggacatggatgaaattggaaaccatcattctcagtaaactatcgcaagaacaa  c.1065-9481

.         .         .         .         .         .           g.113171
aaaaccaaacaccgcatattctcactcataggtgggaattgaacaatgagatcacatgga  c.1065-9421

.         .         .         .         .         .           g.113231
cacaggaaggggaatatcacactctggtgactgtggtggggtcgggggaggggggaggga  c.1065-9361

.         .         .         .         .         .           g.113291
tagcattgggagatatacctaatgctagatgacacattagtgggtgcagcgcaccagcat  c.1065-9301

.         .         .         .         .         .           g.113351
ggcacatgtatacatatgtaactaacctgcacaatgtgcacatgtaccctaaaacttaga  c.1065-9241

.         .         .         .         .         .           g.113411
gtataataaaaaaaaaaaaattaaaaaaaaaaaaacaaaaaaaaaagctagtcccacatg  c.1065-9181

.         .         .         .         .         .           g.113471
gcttacagatgaaatgtatcagctgcataatttggggtgttctacttggcatttataggt  c.1065-9121

.         .         .         .         .         .           g.113531
ggagtctggcagtcccccttctcagggtaaacagatcttacagtggcttttattcagtcc  c.1065-9061

.         .         .         .         .         .           g.113591
atcaggcttgctgttccctcaggaataacctcctgtgtgtctggattatgtacacccatg  c.1065-9001

.         .         .         .         .         .           g.113651
tgcaattgttcagcattgagttgtgggtcctgcatcaaaccaaacatgctcttccattct  c.1065-8941

.         .         .         .         .         .           g.113711
gcagcattcaaaaccaaagatactgcccctaaattagttattctcataatccatttttat  c.1065-8881

.         .         .         .         .         .           g.113771
aaaggttcctcaagaggtggatgatacagatctacaaaatggaatagttcctttacacca  c.1065-8821

.         .         .         .         .         .           g.113831
taccctctagtttcaataattatttggttcttcccttctcccacaggtcaccacaggtct  c.1065-8761

.         .         .         .         .         .           g.113891
cagaggtactttctgttgttcctgcataatttttcccttgtgccatggttctgaggctag  c.1065-8701

.         .         .         .         .         .           g.113951
tggctgaagcttagactcactgaaatctaagtttggtgtatgtagtgtcacggtctaacc  c.1065-8641

.         .         .         .         .         .           g.114011
cagcactttcttttaattttattttagctagtatagataacaataatcaagggattgaat  c.1065-8581

.         .         .         .         .         .           g.114071
agtttgcttttttctgattagtttgcattttcttatgcatccggtgaaccaattctccat  c.1065-8521

.         .         .         .         .         .           g.114131
ctctaaattccattggtaacttttacctttagtaactcagcagagcactgtgacttcata  c.1065-8461

.         .         .         .         .         .           g.114191
tcacaggtgattgtttggccacccaggaatcaagggtttctcatcccccaggcttttatc  c.1065-8401

.         .         .         .         .         .           g.114251
ctttctcttctcaaaccaaatgtttctctgaacctgagccattctagctaatcccacttc  c.1065-8341

.         .         .         .         .         .           g.114311
actaacatcaattgttcctgaaaaactctcagaacatttttttctgtgttcttataccac  c.1065-8281

.         .         .         .         .         .           g.114371
aacaatcaatgaggaagacttctgtgaccctgaaatatgtgggaatttcttctccccagc  c.1065-8221

.         .         .         .         .         .           g.114431
aaacaagcagtcctcttcctgctgggtgtcctccaattcagttctgacaccatctgcctg  c.1065-8161

.         .         .         .         .         .           g.114491
gagatagccttagatcccacaggttgacggctcagtccccaagactgcttccccagacac  c.1065-8101

.         .         .         .         .         .           g.114551
cagtcataagtccagacctccagatcttctgactgactgactttaagttggggttcccac  c.1065-8041

.         .         .         .         .         .           g.114611
agccccttctttgggttcctttaatttgctggagcagctcacagaactcagggaaacact  c.1065-7981

.         .         .         .         .         .           g.114671
taggtttactggtttattttaaaggatattatcaaggatgcagatgaagagatgtgtagg  c.1065-7921

.         .         .         .         .         .           g.114731
gcaaggtatgggggaaggagtgtggagcttccttgccccacttgggtgctcaacccccag  c.1065-7861

.         .         .         .         .         .           g.114791
gaatctgcacatgtttagctatccaggaactgttcaaaccctgtccttttggggttttat  c.1065-7801

.         .         .         .         .         .           g.114851
ggaggcttcattatataggcatgattgacaaccatttaaaaatgtgattgaacaagaagc  c.1065-7741

.         .         .         .         .         .           g.114911
ccatgttctaaacccagaaagacctccttattcagacttttcttggcctctctgtgtagt  c.1065-7681

.         .         .         .         .         .           g.114971
atttcttcctctaggttatggggcaggacattttctggaattagagtcttttgacccaca  c.1065-7621

.         .         .         .         .         .           g.115031
atcagattaaattcctaccttgggcaggtacaaggacactgatagaggcaagaggcacac  c.1065-7561

.         .         .         .         .         .           g.115091
aaattcctaggcagaaacggccaggtccccagtgaaacccaaccttcaagccaggctatc  c.1065-7501

.         .         .         .         .         .           g.115151
agctcagggtggggtccacagccaggagtgagaacttcctcgatgccttttagctaatca  c.1065-7441

.         .         .         .         .         .           g.115211
aatggtgcttttcccaagcccgcctatggaccagtcagcacacactccccgatcctgagc  c.1065-7381

.         .         .         .         .         .           g.115271
ccataaaaaccccagactcagccacatattgggactacctgccttagttagggcaccctc  c.1065-7321

.         .         .         .         .         .           g.115331
tcatacagagggctacccactttgggtcccgtcttgtgttgagagctgttcttgcattga  c.1065-7261

.         .         .         .         .         .           g.115391
ataaaaccctcctccacctggctcactctccagtgtctgtgtaacctcatgcttcttgga  c.1065-7201

.         .         .         .         .         .           g.115451
tgtgggacaagaacctgggacccgctgaacagtaggagtgaaaagggttataacactttc  c.1065-7141

.         .         .         .         .         .           g.115511
ctggctggctcactgagctgagggtggtgacacactcctgttcactagagcagcaaccct  c.1065-7081

.         .         .         .         .         .           g.115571
tctaggggcctagacctcaggattccctgagccagagctgtaacactgtaatcctcccac  c.1065-7021

.         .         .         .         .         .           g.115631
cctttgctggtgctgggcagctgccccacattatgggaactggcagcggtggggctgggc  c.1065-6961

.         .         .         .         .         .           g.115691
cagcccaggagccacgggctggagtggggtggcaggaccaaatgagctgggacatgcccc  c.1065-6901

.         .         .         .         .         .           g.115751
cattcacgaaagcatgcagatggtaggaatgaatgagctataacaggaacaagctgtgat  c.1065-6841

.         .         .         .         .         .           g.115811
gcttcctgggggctcagagcttaggactccctgagcaaaagggtaacaccccttggggct  c.1065-6781

.         .         .         .         .         .           g.115871
ccgcagttgctggcatctccaagttttcaggctctgctgcatcccccaccccttgtccag  c.1065-6721

.         .         .         .         .         .           g.115931
atgctggcacccaaggcagaagccagtcacagcatgcccagcccagctatgggctgagca  c.1065-6661

.         .         .         .         .         .           g.115991
cagagccacagcaggtgtggaacctgggccaataacatgagctaagcattgcctgccagg  c.1065-6601

.         .         .         .         .         .           g.116051
cttaatgggcagagcaagtctagtggcaagcccagagctgagtgaggccccggccagagg  c.1065-6541

.         .         .         .         .         .           g.116111
tgcagctggccaaccgtggagatttctggctggtgaagcagcactgaaagaatcttgtgt  c.1065-6481

.         .         .         .         .         .           g.116171
caacaggagaaggtcagagagagagattgtttcctgacatctgctcctgaggcctaataa  c.1065-6421

.         .         .         .         .         .           g.116231
agcaacccagcattataataaaagactaacaagggctatgggagttaagagccaggaact  c.1065-6361

.         .         .         .         .         .           g.116291
ctggatgtaaaccaatatatatgtattagtccatttttacacagccaaaccatatcaata  c.1065-6301

.         .         .         .         .         .           g.116351
tataatcataatatcacaccaggacagtggacagctcagtagtctgacagcaagaatata  c.1065-6241

.         .         .         .         .         .           g.116411
atgctcaattctaaactggagaatgtaaacacagcaaggaaatcctggatacagcgttga  c.1065-6181

.         .         .         .         .         .           g.116471
attgtaccatgctagactggctgctgctctccatgattttgatctgtcacacatcaataa  c.1065-6121

.         .         .         .         .         .           g.116531
gagacctagaacttgctttcctgagagcaagagatgagtagttttgtttgtaggacacag  c.1065-6061

.         .         .         .         .         .           g.116591
ttaattttgatgcaactaacctaaaagataagcatattctttctcaaccactttgtaaag  c.1065-6001

.         .         .         .         .         .           g.116651
ctgaaagtaaattcagtagcctagaaattgatctccatcatacaagagatgctctcagag  c.1065-5941

.         .         .         .         .         .           g.116711
aaaagaccttggttttagaatctgtacaaagaaacctaagccctcatgcatggcaccagg  c.1065-5881

.         .         .         .         .         .           g.116771
tcggggataaccaggtccacatgtctttatgtctttccacaatgtcagacttttactgat  c.1065-5821

.         .         .         .         .         .           g.116831
actatttcagccacaaaagccatgagctacatggagttcccaaggaatcgattctcagta  c.1065-5761

.         .         .         .         .         .           g.116891
cttccttttcagtcagtagagccataggcacacaggttcaagtcactccacaagtcagtc  c.1065-5701

.         .         .         .         .         .           g.116951
aatattgcaaaccataatagtatacttaatatataattttatagattaaacttcccataa  c.1065-5641

.         .         .         .         .         .           g.117011
caaagtaacatttaacatcaaggaaaaggggataggaaaaagggttaatgaaccactcca  c.1065-5581

.         .         .         .         .         .           g.117071
gggagagagacattgacaaaaagaatatcctggtctggggcaggcagtccctcaatcttg  c.1065-5521

.         .         .         .         .         .           g.117131
caaggaaaagactttgatgtgggcagagccttcagtggcaaatgccgggtgcttatcaca  c.1065-5461

.         .         .         .         .         .           g.117191
agtgacagcaagactgtcagttaagatggccgtttgagctgctgaagtcttgctctttct  c.1065-5401

.         .         .         .         .         .           g.117251
atggccacagagtcctatggtgaggactgaaaatggaggaatgtgcttggttatgtcctc  c.1065-5341

.         .         .         .         .         .           g.117311
atttgattgaatagagtctttattgatcaagtaaaacatctggcctctgttggcaaagtg  c.1065-5281

.         .         .         .         .         .           g.117371
cctaatgaaatgtaagatggagtctttttctgagataaagttacttatgtcaaggatact  c.1065-5221

.         .         .         .         .         .           g.117431
ctatgtgtaagccaaacacagtgtcaaatgaagtaaatcaagcaaatgtattagaatgaa  c.1065-5161

.         .         .         .         .         .           g.117491
taagataaagtaagtaaatacattggaaagcagaagtctgtaaaagagggattatcttga  c.1065-5101

.         .         .         .         .         .           g.117551
ctatagagtaaaaatagaaagccccaaaacttatatggaaacaaatttagtacaacaaga  c.1065-5041

.         .         .         .         .         .           g.117611
atgtggaaacaaatttagtacaagaaagagaccaaagaaagagtaaacaagatatagtag  c.1065-4981

.         .         .         .         .         .           g.117671
aaaagttaaaagaaaatctatctttgcagacacaagcagcatcttgagagaacttagtta  c.1065-4921

.         .         .         .         .         .           g.117731
agagagaataaagttgcttcaataagaagtcgcagggagctgagaaagatctgaaatctg  c.1065-4861

.         .         .         .         .         .           g.117791
aactctcaaaaatgaaaactttccataagactaataaaactgagttggaaaaatataagc  c.1065-4801

.         .         .         .         .         .           g.117851
agctctatctacaagaattaaaagttagaaaatcattggcaactaaactaaacaaaacca  c.1065-4741

.         .         .         .         .         .           g.117911
atgataaaatagcagaggttaatagcaaacttcttgtagagaacagcagatcagattttt  c.1065-4681

.         .         .         .         .         .           g.117971
acaccactcttattacgaggcagtcctagagtcactttgtgtgccgaaaacaggatagtg  c.1065-4621

.         .         .         .         .         .           g.118031
ttcaaagaacattttctagtcactcagaaaccatcaacattgtcagaggccttgaccttc  c.1065-4561

.         .         .         .         .         .           g.118091
agacagatataaacctgattggaagtcttgtgaactctttgagcaccaacacttgtcact  c.1065-4501

.         .         .         .         .         .           g.118151
ggtcagagtttcttttcatatattaaattcgttttcttcactttcagctttagctttatt  c.1065-4441

.         .         .         .         .         .           g.118211
agctagggtatttttataagactcatgagtggggatgggaaaggtgatcttttcatgtac  c.1065-4381

.         .         .         .         .         .           g.118271
tttgttttgttcttacccatccctcccaccaaaaaatgagaccagaactgttaatgttac  c.1065-4321

.         .         .         .         .         .           g.118331
tattgctctgtgagaaaagatatcttggtgaataatttagagacagggctcagaagaaga  c.1065-4261

.         .         .         .         .         .           g.118391
gaggaaaatgtgggaaagtttggaactttagcctagagacttgttgaatggctttgccca  c.1065-4201

.         .         .         .         .         .           g.118451
aaatgttaatagtcatggacaataaactacaggttgaggtgatgtcagatggaaatgaga  c.1065-4141

.         .         .         .         .         .           g.118511
aacttgttgggaactggagtaaaggtgattcttgctgtgttttagcaaagagacttgtgg  c.1065-4081

.         .         .         .         .         .           g.118571
cattttgcccctgccctagagatttgtgaaactttcaactcgagagagatgatttagggt  c.1065-4021

.         .         .         .         .         .           g.118631
atgtggtggaagaaatttctaagcagaaaagcattcaagagctgacttggatcctgttaa  c.1065-3961

.         .         .         .         .         .           g.118691
aggcattcagttttacaagggaagcagagcataaaagtttagaaaatgtgtaccctgact  c.1065-3901

.         .         .         .         .         .           g.118751
acgcgataggaaagaaaaacccattttctggggagaaagtcaagccggctgcagaaattt  c.1065-3841

.         .         .         .         .         .           g.118811
gtgtaagtagcaagtagccgaatgttaattcccaagatgggggaaatgtctccaggtcat  c.1065-3781

.         .         .         .         .         .           g.118871
gtcagagaccttcgcagcagctccttcccctgctcccctacctccgcatcacaggcccag  c.1065-3721

.         .         .         .         .         .           g.118931
aggcccaggaggaaaaagtggtttgtttcgtgggctggactcagggtccccatgctgtgt  c.1065-3661

.         .         .         .         .         .           g.118991
gcagtctggggacttggtgctgtgcatcccagccactccagccgtgtctaaaagaggcca  c.1065-3601

.         .         .         .         .         .           g.119051
aagtacagcttgggctgtgacttcagagagtggaagccccaagccttggcagcttccatg  c.1065-3541

.         .         .         .         .         .           g.119111
tggtgttgagcctgcgggtacacagaagttaagaattaaggtttgagaacctctgcctag  c.1065-3481

.         .         .         .         .         .           g.119171
atttcagaagatgtatggaaatgcctggatgcccaggcaagtttgctgcaggatagcggc  c.1065-3421

.         .         .         .         .         .           g.119231
cctcatggagaacctatgctagtggggaagggaaatatgaggtcagagcccccacacaga  c.1065-3361

.         .         .         .         .         .           g.119291
gtccctactggggcaccacctagtggagctgtgaaaagagggccactgtcctccagacca  c.1065-3301

.         .         .         .         .         .           g.119351
cagaatggtagatctactgacagcttgcaccatgcatctggaagagccgcagacactcaa  c.1065-3241

.         .         .         .         .         .           g.119411
tgtcagcctgtgaaagcagccaggagggaggctgtactctgcaaagccacaggagaaggg  c.1065-3181

.         .         .         .         .         .           g.119471
ctgccaaagaccatgggaacccacctcttgcatcagtgttacctggatgtgagacatgga  c.1065-3121

.         .         .         .         .         .           g.119531
gtcaaaggagatccttttggaactttaagatttgactgtaccactggattttggacttga  c.1065-3061

.         .         .         .         .         .           g.119591
atggggcctgtggcctcttcattttggccaatttctcctattcagaatggctgtatttac  c.1065-3001

.         .         .         .         .         .           g.119651
ccaatgcctatacccccattgtatctaggaagaactaacttgcttttgattttacaggct  c.1065-2941

.         .         .         .         .         .           g.119711
cataggtggaagggatttgtcttgtctcagatgagacactggactatggacttttgaact  c.1065-2881

.         .         .         .         .         .           g.119771
aatgtggaaatgagttaagacttttggggactgttgggaaagcatgattggttttgaaat  c.1065-2821

.         .         .         .         .         .           g.119831
gtgaggacatgatatttgagagggggcaggggtggaatgatatggtttggctgtgtccgc  c.1065-2761

.         .         .         .         .         .           g.119891
acctaaatctcaactcgaattgtatctgccagaattcccacatattgtgggagggaccca  c.1065-2701

.         .         .         .         .         .           g.119951
gtgggaggtaattgaatcctgagggctggtctttcccgtgctgttctcatgatagtgaat  c.1065-2641

.         .         .         .         .         .           g.120011
aagactcatgagatctgatgggtttatcaggggtttccacttttgcttctttctcattgt  c.1065-2581

.         .         .         .         .         .           g.120071
cttttgctgccaccatgtaagaaatgccttttgccctctgccataattgtgagacctccc  c.1065-2521

.         .         .         .         .         .           g.120131
cagccacaaggtggaactgtaagttaaattaaacctcgtttgcttcccagtcttgagtat  c.1065-2461

.         .         .         .         .         .           g.120191
gcctttatcagcagcgtaaaaatggactaatgcattacattggtaccaggagtggggtgt  c.1065-2401

.         .         .         .         .         .           g.120251
tgctgaaaagatactcaaatatgtggaagtgactttggaactgggtaacaggcagaggtt  c.1065-2341

.         .         .         .         .         .           g.120311
ggaacagtttggagagctcagaagaagacaggaagatgaatgaaagtttggaactgccta  c.1065-2281

.         .         .         .         .         .           g.120371
gaaacttgtagaatagttttgaccaatgaagtccaggctgagatggtttcagatggagat  c.1065-2221

.         .         .         .         .         .           g.120431
gaggaacttattgggaactggagcaaaggtcactcttgctgcgttttagcaaagagactg  c.1065-2161

.         .         .         .         .         .           g.120491
gtggaattttgcccctgccctagagatctgtggagccttgaacttgagagaggtgattta  c.1065-2101

.         .         .         .         .         .           g.120551
gggtatctggtggaagaaatttctaaggagcaaagcattcatgaggtgacctggcttatt  c.1065-2041

.         .         .         .         .         .           g.120611
ctgaaagcattcagtcatattcattcacagagatggtttgaaattggaacttattaaaag  c.1065-1981

.         .         .         .         .         .           g.120671
ggaagcagagcataaaggtttggaaaatttgcagcctgactgtgaggtgaaaaagaaaac  c.1065-1921

.         .         .         .         .         .           g.120731
cccattttctggggagaaattcaagccagctgcagaaatttgtgtaagtaacaaggagct  c.1065-1861

.         .         .         .         .         .           g.120791
gaatgttcataccaagacaatagggaaaatgtctccagggcatgtcagagatcttcacag  c.1065-1801

.         .         .         .         .         .           g.120851
ctgcccctttcatcacaggcccagaggcctaggagtaaaagtggtttcgtgggcctggcc  c.1065-1741

.         .         .         .         .         .           g.120911
cagggccccactgctctatgcagcctcaggacttggtgccctgtgtcccagatgctccag  c.1065-1681

.         .         .         .         .         .           g.120971
ccatggctaaaaggggccaaggtacagcttggcttttgcttcagagggtgcaaaccccaa  c.1065-1621

.         .         .         .         .         .           g.121031
gctttagcagcttccatgtagtgttgggcctgcaggtacacagaagacaagagttgaggt  c.1065-1561

.         .         .         .         .         .           g.121091
ttgggaacctctgcctagatttcagagaatgtacggaaatacctggatgtccaggcagaa  c.1065-1501

.         .         .         .         .         .           g.121151
gtctgctgcagggctggggccctcatgaagaacttctgctatggcagtgcagaagggaaa  c.1065-1441

.         .         .         .         .         .           g.121211
tgtggggttggagcccccacacagagtccccactgggacactgcctagtggagcactcag  c.1065-1381

.         .         .         .         .         .           g.121271
aagagggccaccatcttccagaccccagaatggtaaatccagtgacggcttcctctgtgc  c.1065-1321

.         .         .         .         .         .           g.121331
accttggaaaagccgcaagcacttaataccagcctgtgaaagcagccacaggggctgtcc  c.1065-1261

.         .         .         .         .         .           g.121391
cctgcagagccacaggggtggggcccaaggcctagggagcccacctcttgcatcagcatg  c.1065-1201

.         .         .         .         .         .           g.121451
tcctggatgtgagacatggaatcaaggagattttggaggttttatatatatatatatata  c.1065-1141

.         .         .         .         .         .           g.121511
tatataaattttttttttttgagacggagtttcgctcttgtcacccaggctggagtgcaa  c.1065-1081

.         .         .         .         .         .           g.121571
tggcacgatcttgactcaccgcatttggaggtttaatatttaatgattgcctggccaggt  c.1065-1021

.         .         .         .         .         .           g.121631
tttgcacttgcatggggcctgtggcccctttgttttggccattttctcacatttggaaca  c.1065-961

.         .         .         .         .         .           g.121691
ggaatatttaccccctgtatccccattgtatcttacaagtaactaacttgcttttgattt  c.1065-901

.         .         .         .         .         .           g.121751
tgcaggcttataggtggaagggacgtttctaattggtgtaggttcttaaaacatagaaaa  c.1065-841

.         .         .         .         .         .           g.121811
aataggctttcttagtactaccctttgtgtctacttaaaaaagttatttttcgattttat  c.1065-781

.         .         .         .         .         .           g.121871
tttcctataaattcattgttttcatccaaacagcagctgcagttgcaggcatttttatga  c.1065-721

.         .         .         .         .         .           g.121931
ccaactcacggatagtcttactttagagaacccagactaatacactgccctttgtaagct  c.1065-661

.         .         .         .         .         .           g.121991
gttgttggtaatgtgtgttaaaggcagataggggccaaaaggtattcaaaagtataagca  c.1065-601

.         .         .         .         .         .           g.122051
attagacacaaaaagttctcagacttgggtggccttattgagggaaacgagcatggttgt  c.1065-541

.         .         .         .         .         .           g.122111
gcctcattatctgaggatttctaggatagcctcactgcccaaattctcttccccacctgc  c.1065-481

.         .         .         .         .         .           g.122171
cagccaggggcccaacatgcatttgcatctcagtggctcctttttaggccatcaggaatt  c.1065-421

.         .         .         .         .         .           g.122231
tttttgttaaataccaagttcatctgaaaagatgtgaggattagttcacactcacttgaa  c.1065-361

.         .         .         .         .         .           g.122291
aacaggactggtagaaataagatctagagcacactggccaacttcacttcagtaacctgc  c.1065-301

.         .         .         .         .         .           g.122351
cactctcaccacacaaatcaggcagccgtattatggcaggggcttgtaaaaactgaggaa  c.1065-241

.         .         .         .         .         .           g.122411
caagccccttgtgtctcagtttctcttctgtttccagtaatgtacagtgttcatgcattc  c.1065-181

.         .         .         .         .         .           g.122471
ttttctttttttgttgttgtttaaaaattttatttattttataagtcactcaaatttctt  c.1065-121

.         .         .         .         .         .           g.122531
ctcttaactatttcagtttagtattacacagtatacagagtgggatgtaagaaccataaa  c.1065-61

.         .         .         .         .         .           g.122591
ctgttccataaccacgtttgaatcaaataatcatgatttgtgttccctttggcatctcag  c.1065-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center