beta 3-glucosyltransferase (B3GLCT) - 6065 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.122771
gtaactatgatcacagctttcttcaactactttaaacataaacttccctttccacacgag  c.1184+60

         .         .         .         .         .         .  g.122831
aggtaggtctctggcactgggatctatactgtacgtgagtactctgtgaatggtggttgt  c.1184+120

         .         .         .         .         .         .  g.122891
tactataataggaaagtgaacattatatttgctaaatattaaaagaacactcagtaaaga  c.1184+180

         .         .         .         .         .         .  g.122951
atattttagcccttgaagaaatgatataaaaaagtatgtcatacttgctagaatgtccct  c.1184+240

         .         .         .         .         .         .  g.123011
aacaatggttgcttctagacagccaactagttttgattgtctatttaaatggaaaaaaaa  c.1184+300

         .         .         .         .         .         .  g.123071
aattggttatagattttaatctcagagaataagccattagactattaaattatgtaatgc  c.1184+360

         .         .         .         .         .         .  g.123131
ttaataaatcgcctttggagaaagtgtagtatagaagcttacttaggcaattaagtaata  c.1184+420

         .         .         .         .         .         .  g.123191
tttatgtaggatttataggttttaaataacagttaaaaatcagtgttttaaatgaagcat  c.1184+480

         .         .         .         .         .         .  g.123251
ctgcctaatctcatacgaagaaagattttaacttgatttatatgggtaaatcaattaagc  c.1184+540

         .         .         .         .         .         .  g.123311
agttttccctattacttctgtagtcttactattggtgcgtgtaggcaaaatcttatcaac  c.1184+600

         .         .         .         .         .         .  g.123371
ggtagtcatttaaattcactcagtagatatttgttgcatgtcttctgtgttccaggcagc  c.1184+660

         .         .         .         .         .         .  g.123431
attctagtttataatctaatggattatacacttctggagggctaggacctttaattccta  c.1184+720

         .         .         .         .         .         .  g.123491
ctttgcaattccctagattggaacaattcctacaggaacctgcaggatctcaacagtcgt  c.1184+780

         .         .         .         .         .         .  g.123551
actacaggcatcctgattttgtttagccaatacagtggtgaagataacacggttatggtg  c.1184+840

         .         .         .         .         .         .  g.123611
gtggctcttttgtagtgataaccaaacctgagcatgtgtgctgatctttgttagacgatg  c.1184+900

         .         .         .         .         .         .  g.123671
gcttgcatctacctgaggtcattaacaacaggagggggagtccagggaggcctttgaaaa  c.1184+960

         .         .         .         .         .         .  g.123731
gacactagagtaagcccaaggagtgttgacctccttatcaaaaaaggttcaagctatttg  c.1184+1020

         .         .         .         .         .         .  g.123791
cggccttactgtaatgcatcgggctttctgggtgaagagttagggccaattaaggatcag  c.1184+1080

         .         .         .         .         .         .  g.123851
aacatggcacccattgagccaggatgttccactttgaaagtggccctgttatttgtatat  c.1184+1140

         .         .         .         .         .         .  g.123911
gggtttatatactttatagcatgatggcgttcatataatatttttaacacagaagtgact  c.1184+1200

         .         .         .         .         .         .  g.123971
tgttatatgatttctgcaagaaaaccattttgttgtcttcattgcatattggatttagct  c.1184+1260

         .         .         .         .         .         .  g.124031
gttgtttccaagactggcactcaaggccttctgaaacctcactttaccttacctatctag  c.1184+1320

         .         .         .         .         .         .  g.124091
aattgcctttcatcatcccagttggttgtttattcgttcaactggccttgtgtgggccag  c.1184+1380

         .         .         .         .         .         .  g.124151
gcacagggaatgcacagatgaaagctgcacagccccttccccacaggacctcacaggcca  c.1184+1440

         .         .         .         .         .         .  g.124211
gtgccagatttgcaaatacattgcataattgtcactgctcccccttcccttgcccctggc  c.1184+1500

         .         .         .         .         .         .  g.124271
aggctgtgctagaccaccaaggtggcacctttaacttctgtgctcagcgtctaccctgcc  c.1184+1560

         .         .         .         .         .         .  g.124331
cctgggtacttcccaccacctctagtttttctgtcttaaaacttctcaccaccaccatgc  c.1184+1620

         .         .         .         .         .         .  g.124391
cttctccttcctaccctgcggaacatcttgagttcactactctatctccattttctcagc  c.1184+1680

         .         .         .         .         .         .  g.124451
tccatgctcagccttctaagagtcataaactcccagcctcctaaactacctcaccaaggt  c.1184+1740

         .         .         .         .         .         .  g.124511
ttccagcaaccttgctgtcgctaaatcaaattaataatttccaatttttatcctgtttca  c.1184+1800

         .         .         .         .         .         .  g.124571
ctgacagcctttaacaccagtgactgttgacctgaaacacccctttctcttgctttccag  c.1184+1860

         .         .         .         .         .         .  g.124631
agcgccatcctatccttgttcatccttctttctggtcattccttctcagttgtttctgtc  c.1184+1920

         .         .         .         .         .         .  g.124691
tatcccttcaatgtcttgtgttactcaggcatcttttctagtcctccttctcaccctgta  c.1184+1980

         .         .         .         .         .         .  g.124751
ttgtccctgggtgatcttatggcttgatgctgaatgtacccagaactctttctccagcct  c.1184+2040

         .         .         .         .         .         .  g.124811
agaactctgctggcctctggattcatagattcaaagggcatctccacttgactgattgac  c.1184+2100

         .         .         .         .         .         .  g.124871
agacacatcacactcaacaccttgtcatttctgaccgtaacccctgatttgttcttccaa  c.1184+2160

         .         .         .         .         .         .  g.124931
tgtccccctctcagggaaaacattggcatatatgagttcttatcccaggagtctgtgagt  c.1184+2220

         .         .         .         .         .         .  g.124991
cagctctcaccctttctttccttctttccccactccctgcaatcaactgaatcacccagt  c.1184+2280

         .         .         .         .         .         .  g.125051
cctgtccattttatttcctaaatctctcttccatcaatacttctctctacctccagtaat  c.1184+2340

         .         .         .         .         .         .  g.125111
ctcagccaggtcactgtcatatcctatatgagctcctgccacagcctcctgttcccccta  c.1184+2400

         .         .         .         .         .         .  g.125171
ctttttggtcttaaactccactccatgctgttgtccacactgtagtcaaagggacctttc  c.1184+2460

         .         .         .         .         .         .  g.125231
taaaagcagatctggtcctgtctcccctctgctcagaggccctcagtggcttctcattgt  c.1184+2520

         .         .         .         .         .         .  g.125291
cttttctccaagagtgtgaacctttttctacttttgacatctaagacaaagagatgatca  c.1184+2580

         .         .         .         .         .         .  g.125351
tttagattttaacaagagtcaagttgatctgggatgagtcctcaatttaatcttctctag  c.1184+2640

         .         .         .         .         .         .  g.125411
tttgcctgattaccagcctccctgggtgttgctgaggccactgctttgggcccgaaagcc  c.1184+2700

         .         .         .         .         .         .  g.125471
caagaaaagttttgtcttctacccacttaccaggcccagtttgccgctgaaagctgccat  c.1184+2760

         .         .         .         .         .         .  g.125531
ggctgtcttgctactcccctagcaaggatttttctctctagaaattcattcatctaggct  c.1184+2820

         .         .         .         .         .         .  g.125591
tcgtgtcattcacctctcttcaatttcataattacatatgattttcctgttatttgaata  c.1184+2880

         .         .         .         .         .         .  g.125651
tttttatttgagtgttaccatggcatgaaagtcttttgcatcttctgatatcctaactgg  c.1184+2940

         .         .         .         .         .         .  g.125711
cagtagaacttctcccattgcctttaggatcaagtctgcactccaaggcttataagacct  c.1184+3000

         .         .         .     g.125744
ctcatgatcttggcagatgctgttttacctttc  c.1184+3033

--------------------- middle of intron ---------------------
               g.125745       .         .         .           g.125776
               c.1185-3032  tagcctcatccatctacacccttatcttaaag  c.1185-3001

.         .         .         .         .         .           g.125836
aactcttgctgaacttgtttcagtttctctgaagcactatttttttcctctcctcccaag  c.1185-2941

.         .         .         .         .         .           g.125896
atacgacattcgctggtctctgcataccattgtttccccaactttctgcctgtctagttc  c.1185-2881

.         .         .         .         .         .           g.125956
ctccttgttcttttggactcaccatagctatcaccatttactcttgaatgcctttagccc  c.1185-2821

.         .         .         .         .         .           g.126016
aatctagcctctcaaatctgggtttaatgcatttctaatgtactttcatagcatattatg  c.1185-2761

.         .         .         .         .         .           g.126076
caaaccattatcatttaattgcctatttacttttctattttccacttaaattatgcatta  c.1185-2701

.         .         .         .         .         .           g.126136
tttgaaggcaacacctgtgtgtttcatttctcgttatttcctcgcttcttagcataggga  c.1185-2641

.         .         .         .         .         .           g.126196
ctcatgtttttcaaggtacagtgaataaatgaataaacaaatccatgaacacaaggcact  c.1185-2581

.         .         .         .         .         .           g.126256
gatctttatatagctaacattgaccaatgtgatgttctgtctttaatagcgcttttacaa  c.1185-2521

.         .         .         .         .         .           g.126316
agatgcaggaacattcgtcatgagattgtctcttacatcaacctttgataaaagctgtaa  c.1185-2461

.         .         .         .         .         .           g.126376
gacataatgttgaatagtttctctagtattacagcagaattttctgatgctctagcttga  c.1185-2401

.         .         .         .         .         .           g.126436
gaaccaatatgccttttaacagcaagtcagaatcagtggcttgtaaaaccaattcatgga  c.1185-2341

.         .         .         .         .         .           g.126496
ccatgactagcattttaaattaatgaactattgagtggaatagaataaaatggaaaatat  c.1185-2281

.         .         .         .         .         .           g.126556
cagagtgcattccatgtcataagggtaagtattgtttgtgacatttttgtttcagcttta  c.1185-2221

.         .         .         .         .         .           g.126616
tacatacccatgcacactcacacatgaaacatataaatggttgcaatgtgaaattaattt  c.1185-2161

.         .         .         .         .         .           g.126676
cttgttttctgatggcgggtcacagtccagtaagtttttgaaaaccactaccttaaacca  c.1185-2101

.         .         .         .         .         .           g.126736
tccatcttaggtaaggatgttttgacagagccgagtcagacatgtaggttcctgtggttt  c.1185-2041

.         .         .         .         .         .           g.126796
ctgtgtaggtattttgcgttgtttggagcatgagacctttgtactatttgaatccaagtg  c.1185-1981

.         .         .         .         .         .           g.126856
tctgtttttcactttgttgcttactccatgaaagttttggtacttggagaaaataaattg  c.1185-1921

.         .         .         .         .         .           g.126916
aatgaccattttttttttattatttcaacaggcttttgaggggcaggaggtgtttggtta  c.1185-1861

.         .         .         .         .         .           g.126976
tatgaatgagttctttagtggtgatttctgatattttggtgcacctgtcacccaagtagt  c.1185-1801

.         .         .         .         .         .           g.127036
gtacgctgtgtccagtgtgtagtcttttatccctcatccccacccctcttccgagttccc  c.1185-1741

.         .         .         .         .         .           g.127096
aaagttcattgtatcattcttatgcctttgcatcctcataacttagctcctacttatagg  c.1185-1681

.         .         .         .         .         .           g.127156
tgagaacatgtgatgttttgaccatttctttttgaaaatacttatttacatatgtgcatt  c.1185-1621

.         .         .         .         .         .           g.127216
taggtaggaagctgtgcttaggctatctatcatcagcctttttggcagccttgggagcaa  c.1185-1561

.         .         .         .         .         .           g.127276
atgactacaccagaataagatgttgggcaatgtcctcggaagaggccgcaggcagtgtta  c.1185-1501

.         .         .         .         .         .           g.127336
cccagagagactgccatgacctatttattggctgaaggccaggaagggcaggcatgtttc  c.1185-1441

.         .         .         .         .         .           g.127396
tcatgcatgttcccttcctacatcgtcttgatctgcactgtgttcttgggcaagtcccag  c.1185-1381

.         .         .         .         .         .           g.127456
actcccatttcagtttttcttattttaaacatttgtatattgtatattgaaggaaataaa  c.1185-1321

.         .         .         .         .         .           g.127516
ataatcctgtagcctttcaacatctttttaatgtttaatagttggtggccagagcagaca  c.1185-1261

.         .         .         .         .         .           g.127576
agtgttctttcccacgatgatatgactggtagttttccattttggggagcaaccttattt  c.1185-1201

.         .         .         .         .         .           g.127636
ggaaagaactcatcagcatgctaataaacaagtgttattaacggctcatattcacttagt  c.1185-1141

.         .         .         .         .         .           g.127696
ttatgcaaataattaatgtaagactgtgtgagtaggcaaaagtataaaataattacatat  c.1185-1081

.         .         .         .         .         .           g.127756
taaaatttcatgctcacgtttcatcttcctataaagttagtttttcagagagcggatcaa  c.1185-1021

.         .         .         .         .         .           g.127816
aaaaatgaaagtctttctcattttttctcattttactagatgctgacaaaagaaaaaaag  c.1185-961

.         .         .         .         .         .           g.127876
catttttactatttactgtcaacacatcttctcatgtgtgctcttttcccggagtcagta  c.1185-901

.         .         .         .         .         .           g.127936
gcttgagcccaacgtggccgattgggtgtaggagttccactcagccacaaaaaatgtggc  c.1185-841

.         .         .         .         .         .           g.127996
cagggaggtttcactgtggacagcaggctttctaagagaaaggcaatttatggtgggttt  c.1185-781

.         .         .         .         .         .           g.128056
tcagacttgcagttttcctttctctgtagttgacaggaactttctttttataccttccta  c.1185-721

.         .         .         .         .         .           g.128116
ttttgttacaacatcttaagtaaagaaattctcttgtctagtcaagggcagggagggagt  c.1185-661

.         .         .         .         .         .           g.128176
tctgcactgttgcaggggacggaggagggggttggccactagcattaggtaaaactgctg  c.1185-601

.         .         .         .         .         .           g.128236
aattgagcccagcatgtggaatcagtatttttgattcagggattcaagctctttgtcctt  c.1185-541

.         .         .         .         .         .           g.128296
ttttccttcctcctagactgattcatagaatgtttcctcccccaggaagaaggtctttgt  c.1185-481

.         .         .         .         .         .           g.128356
aaaggcgactttgttctcacttgtttgatgcatcaaacttccattgagtgctgtgggcaa  c.1185-421

.         .         .         .         .         .           g.128416
ggccctatatgtggcagtgggactatatggatgaattttaaatagttttgccttaaagaa  c.1185-361

.         .         .         .         .         .           g.128476
agtctttgatgattgagactgaacttatgaaccatattgtttccttcggccctttcagtt  c.1185-301

.         .         .         .         .         .           g.128536
attgagctttttatggtatgaaaagattcatttctaccttaggatcagaatgaaaacaag  c.1185-241

.         .         .         .         .         .           g.128596
aaaccaatctgtattttaaaacgaagagaaattattttgggaacttggtacaaaagtgtt  c.1185-181

.         .         .         .         .         .           g.128656
ggaaagggccagaagactaaaagagaacaggtagggttttacctagagctcagtaactag  c.1185-121

.         .         .         .         .         .           g.128716
agaaagctactattgcctctcagtctgcaggagtaaagtcctgtttcccggggcccattt  c.1185-61

.         .         .         .         .         .           g.128776
gtgcagcagcggtgtctgtggagcttctctaacccctttctctgctctggctcccactag  c.1185-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center