beta 3-glucosyltransferase (B3GLCT) - upstream reference sequence


                                          g.1     .             g.10
                                          c.-5110 ctttctttcc    c.-5101

.         .         .         .         .         .             g.70
cctctctaatccatccacaacattaacactgaattaaacttctcacagcactgatcaatc    c.-5041

.         .         .         .         .         .             g.130
attaaatcagtacccaactcacgtgaactgagtgttcatcatgtgaattcatcacaattg    c.-4981

.         .         .         .         .         .             g.190
aaatattcattatttttctgataggggttgccgagttaggacaccaggtaggccttacga    c.-4921

.         .         .         .         .         .             g.250
gctacagtcttgtagtggaggttttggtcatcacctgctgaaacatccttccatctatcc    c.-4861

.         .         .         .         .         .             g.310
actgctcattgccccactcaagggaaggccattctcctagcacggtgcccaagcccctgc    c.-4801

.         .         .         .         .         .             g.370
tcggtacggtcctaaccagcctcccctccatgttccctcgtgctggccaaactaaacagc    c.-4741

.         .         .         .         .         .             g.430
tcctcagtctctgaactctcggtcttccatggcatttcttgcttgtctcctctgcttgga    c.-4681

.         .         .         .         .         .             g.490
atgccttctccccttctctcttggcaaccgcgccatctcggtgaggccccatgcagcccc    c.-4621

.         .         .         .         .         .             g.550
actgatgaatgtgctttccttctccttgcccttgttcgtacgcttcttaggggatttcca    c.-4561

.         .         .         .         .         .             g.610
tgttccaggagggtttatggctatttctgtatgtcctggtcctcctaactagactgtgat    c.-4501

.         .         .         .         .         .             g.670
ctcccccaggaaaatgcattttcctccaaactcagcatgccatatgagggcctcatacat    c.-4441

.         .         .         .         .         .             g.730
gcagttagtccgtgatacattcgtcacaaacacataaaatttttgttgagcttattaagc    c.-4381

.         .         .         .         .         .             g.790
aagatcctacatctgaaagcagctgttgtaaaatgaacaactacttattagcaacagcac    c.-4321

.         .         .         .         .         .             g.850
caaaaacaccaacacattttgtgtgggctgctgaacagtcatgccccacgccttctgttc    c.-4261

.         .         .         .         .         .             g.910
ttagtgaaagtcaaatgcagacacttcctgtcatgcctgctatgagtgattcctgatctt    c.-4201

.         .         .         .         .         .             g.970
tactgggaacagaaggatatgtgattctacaaaggagagcgaaacagccaagtagatcat    c.-4141

.         .         .         .         .         .             g.1030
ctatttctgattagaagtttctaggatagctttcttgtagacaggctttatatcactctg    c.-4081

.         .         .         .         .         .             g.1090
tgtcttcaaatgtcaatggcttcagatttctgggctttcctggggggtctgctgagatgg    c.-4021

.         .         .         .         .         .             g.1150
taacctgttatatttcctggattttggttcagggttgttaggctgtgagaatccctttgt    c.-3961

.         .         .         .         .         .             g.1210
taagcttctttgaataaaaatcttggttgaaagtttggtttgacagaatgggttttgcct    c.-3901

.         .         .         .         .         .             g.1270
aaatatatatatatatatatatatttttttttttccagacagaatctcactctgtcgccc    c.-3841

.         .         .         .         .         .             g.1330
aggctggagtgcagtggcgtgatctcggctcactgaaacctctacctccccagttcaaac    c.-3781

.         .         .         .         .         .             g.1390
gattctcctgcctccccctcctgattagctgggattacaggcgtgcgccaccatgcccag    c.-3721

.         .         .         .         .         .             g.1450
ctaatttttatatttttagtacagatgggctttcactacattggccaggctgatcttgaa    c.-3661

.         .         .         .         .         .             g.1510
tgcctgacctcaaatgatccacccgcctcagcctcccaaaatgctgggattacaggtgtg    c.-3601

.         .         .         .         .         .             g.1570
agccactgcacctggccttgcctataatttttgaatagctttggaagcaatgtgagacaa    c.-3541

.         .         .         .         .         .             g.1630
gctccctgagggcattaaagaaaccaccgtatgtcatcaaaggattcttcctgagtacat    c.-3481

.         .         .         .         .         .             g.1690
gcagtggggctgtggctctgggtcctctctgagtgatgaaagttttgctccctctcttct    c.-3421

.         .         .         .         .         .             g.1750
cttcctgtctccctcttctccacggggatcatagattatcttccttcccaaaacgctaaa    c.-3361

.         .         .         .         .         .             g.1810
gcgtaaggtacaagtgatgagtctttctcctgtaaccccctagtgtgcactgattgtggg    c.-3301

.         .         .         .         .         .             g.1870
gtgtgaggatggtgagcagatgattaaagtactgtagcataggtctgatattataatgac    c.-3241

.         .         .         .         .         .             g.1930
cttaagtcccggagaccctgttttagacattctattttactattaaaccttaagacctga    c.-3181

.         .         .         .         .         .             g.1990
ttttaggtttggaaaataatcctcaagaccactcataattcataaacctgctgttttatg    c.-3121

.         .         .         .         .         .             g.2050
caggaagagaatagtcctcctgaattgtgttgactgctaatccactttaggcctgacact    c.-3061

.         .         .         .         .         .             g.2110
gagtgaaagggcaccgagagtgggaagagttggaatatgccctttgggctttgctagtat    c.-3001

.         .         .         .         .         .             g.2170
agaaacagggtgcctgggaggccccttccaagtcacaggagagaggcagcaggctggagg    c.-2941

.         .         .         .         .         .             g.2230
gggcacagtgagaagctgttcctccttgcagcccctctccccacccgccacactactgtt    c.-2881

.         .         .         .         .         .             g.2290
gatttgcacattcgtgctgtgcctcagcctggggcgcctgtcctcctttctcagctcagg    c.-2821

.         .         .         .         .         .             g.2350
aacctgctatttctcctttaagatcctgtgcaacagtcgcttcttttcttacagattcca    c.-2761

.         .         .         .         .         .             g.2410
aaggccctgagagatttttttttccctgtgtgttccaaagtgtgctgatctacgcatgcc    c.-2701

.         .         .         .         .         .             g.2470
atagcatttataagaaggtagcaaagttagttatgaacatttttgtctcccaaactggac    c.-2641

.         .         .         .         .         .             g.2530
cgtgagttcttgggcccaggaccatgttttatgctctttaatatctgccccagagcttag    c.-2581

.         .         .         .         .         .             g.2590
caaagggcacatcagctagaggtgctccctatcatttgaatgaatggagttcagcctttt    c.-2521

.         .         .         .         .         .             g.2650
gggcctcaaggataactgttgtaagatcagaaaccatctgtttggaacttgttcattaga    c.-2461

.         .         .         .         .         .             g.2710
ttatttggctctcagtggttttagtatgtctttatgttctcctttagtatttagaaaatt    c.-2401

.         .         .         .         .         .             g.2770
atctgtaaaattaccagtctgttttaaccaggttgcgacagtgccttccccaacaaaaga    c.-2341

.         .         .         .         .         .             g.2830
tggctccttgcttcttcccctgtccctcaacaaagaaagtttcaggggccagcatggagg    c.-2281

.         .         .         .         .         .             g.2890
tgacagctgggattgagtaaatcccaagaagatggcttgcttgttttcatatcacaatct    c.-2221

.         .         .         .         .         .             g.2950
taaagtttataggatttattttttttctacttagagttgttcctttacagtcaatgttat    c.-2161

.         .         .         .         .         .             g.3010
aggcaagcagtgcctatcatgtatctgttagtatcctcatcagtacgttgctctaggaaa    c.-2101

.         .         .         .         .         .             g.3070
ctctcctgacatgtgattgggagagagaactcccagcaagtccatttatcatatgactag    c.-2041

.         .         .         .         .         .             g.3130
agtaagtgaaaggcaattctttttaaaatgtgagttatggagctttgtaatgtgccattt    c.-1981

.         .         .         .         .         .             g.3190
atctatgtctactgtggaaaggaaggacaccagggcaagtttattacttaaacggtgtgt    c.-1921

.         .         .         .         .         .             g.3250
tctctgttgtccttagggcttaattttccacaccttgttctggaacatagtaatactcta    c.-1861

.         .         .         .         .         .             g.3310
acatgatgaatttccatgaaaacattgattaagcaccaggagttgcttacccacgtggag    c.-1801

.         .         .         .         .         .             g.3370
taggcatttgaccctgcttattagtcttctgtgtctaattaaacagtttggttaaatgtt    c.-1741

.         .         .         .         .         .             g.3430
tactaccccacatatgcaaggaatattttcttggaaaaaagcgaaaacagctttggaaat    c.-1681

.         .         .         .         .         .             g.3490
tggaaacaatctagaactactaggcaggtaagcttgagaatttcccaaggataaaagcaa    c.-1621

.         .         .         .         .         .             g.3550
tgaattcagtcaaccatagatttgaaatgcttcactaagaaatgaaatggaaggatccct    c.-1561

.         .         .         .         .         .             g.3610
acatttctttttcctcccatcaaaatggtattgacaagagaccataaaccttgggcgaat    c.-1501

.         .         .         .         .         .             g.3670
ggaacaaaagggaactatttgcactcacactaaatggatcacacgtgaaatatttagttc    c.-1441

.         .         .         .         .         .             g.3730
ccagttttaagaagtcaatataaaccacacagagagaaaattctttgtctccaggcctcc    c.-1381

.         .         .         .         .         .             g.3790
ttttcaaaacaatcccagcaggtattgcacaattgcagacaatactgtcctaatgcatta    c.-1321

.         .         .         .         .         .             g.3850
gagcctaagtcccctaaacgcattcaagttaagagggctcaagcctacaaatgtttattc    c.-1261

.         .         .         .         .         .             g.3910
agcacctgcttctctgtctccaggacatcctacttgtattcccagggccatcctacttgt    c.-1201

.         .         .         .         .         .             g.3970
actcccagggcctcctcctccttaaatgtttagcaagtaggtgaatgttgtatgtccatg    c.-1141

.         .         .         .         .         .             g.4030
tgaaagatactggcattcctagggtgcttagcagagttgcagtcacatagtaggtatcca    c.-1081

.         .         .         .         .         .             g.4090
acaaatgagtaaatatgaaggaaaacatagaaactgccttcaagaggtcatgggctaaac    c.-1021

.         .         .         .         .         .             g.4150
tagggctgggaaaagcacttggtcctgtgcacttccttggaaacagaagtgagccaaggc    c.-961

.         .         .         .         .         .             g.4210
ttgagggaggcacgaaggagttcagaaccactgaagggagcctctagttcttacttgtaa    c.-901

.         .         .         .         .         .             g.4270
tgctttccccttcagtgcaccacacaacacaacaggaccagtcccctatcagggccacca    c.-841

.         .         .         .         .         .             g.4330
ctctaccgggctggggaggaaagcccttcgcagtcctgcgggaacaggaggcactcccac    c.-781

.         .         .         .         .         .             g.4390
attgctccacttctctgtattccagtttaattaatttttatattttgaataaaattacac    c.-721

.         .         .         .         .         .             g.4450
ccactctcttccattatggtgaacacttaaaattacatttatagaaaattacatttacac    c.-661

.         .         .         .         .         .             g.4510
aaacttgtttaaaagccaaatcccagacctaggctattggccaaattccatttaaagggg    c.-601

.         .         .         .         .         .             g.4570
atattaagtaaattagttgagctgattaaaaacaccttcatcaaagtagagcattggtgc    c.-541

.         .         .         .         .         .             g.4630
caacaatattaagagttgaactattgattacatttttttttccacagcagataatacatt    c.-481

.         .         .         .         .         .             g.4690
agcagggaggaaaagtgattactgctcgcttccacttcacaggtagaactactgatgggg    c.-421

.         .         .         .         .         .             g.4750
gtgacgcggtaaggtgggagggcatgaaggcaggggacgcggcctaggtcaggagggacg    c.-361

.         .         .         .         .         .             g.4810
cagaggagaaaggaagaggaggggtggaggctggtggctggagggggcagaggtcagacg    c.-301

.         .         .         .         .         .             g.4870
cctcgaaggagggcgccgtgagggcagagccgcggccacctctaccgcagcagcccgtcg    c.-241

.         .         .         .         .         .             g.4930
ggccggacaccagccgcagccgccagcccggcagacgctggaagcgcgcacaggggtgct    c.-181

.         .         .         .         .         .             g.4990
cccgctcccggccgccagagggcgcggccggcgatggcgcggcggagacggagggaggag    c.-121

.            .         .         .         .         .          g.5050
gggagccggc \ agagaagggtcagccgcggcggcagggcggcggcggcagcggcgcagctc c.-61


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center