B9 protein domain 2 (B9D2) - coding DNA reference sequence

(used for variant description)

(last modified May 7, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_030578.3 in the B9D2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000019.9, covering B9D2 transcript NM_030578.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5040
                     aggggaggagcctgctgttgccccagcaacaaccacggaa       c.-181

 .         .         .         .         .         .                g.5100
 accaagacgagcgcggtcgcggaagtatcgcggcttacatatctcgcagccaggcgggtc       c.-121

 .         .         .         .         .         .                g.5160
 ctgggagaggcgcgagccaggcctggtcggcgcccgcggagaaaagaagcagtcaagccc       c.-61

 .         .         .         .         .         .      | 02      g.5654
 atgaactacaaccccggttgccgctttctcctctcctaaccgttaagtgcgctaag | ggcc    c.-1

          .         .         .         .         .         .       g.5714
 ATGGCTGAGGTGCACGTGATCGGGCAGATCATAGGGGCCAGCGGTTTCTCGGAAAGTAGC       c.60
 M  A  E  V  H  V  I  G  Q  I  I  G  A  S  G  F  S  E  S  S         p.20

          .         .         | 03         .         .         .    g.11183
 CTCTTCTGCAAGTGGGGCATTCACACAG | GGGCGGCATGGAAGCTCCTGTCAGGCGTGCGG    c.120
 L  F  C  K  W  G  I  H  T  G |   A  A  W  K  L  L  S  G  V  R      p.40

          .         .         .         .         .         .       g.11243
 GAGGGCCAAACGCAAGTGGACACCCCGCAGATAGGGGACATGGCTTACTGGTCCCACCCC       c.180
 E  G  Q  T  Q  V  D  T  P  Q  I  G  D  M  A  Y  W  S  H  P         p.60

          .         .         .     | 04   .         .         .    g.14186
 ATCGACCTGCACTTCGCCACCAAAGGTCTTCAAG | GCTGGCCCCGGCTCCATTTCCAGGTG    c.240
 I  D  L  H  F  A  T  K  G  L  Q  G |   W  P  R  L  H  F  Q  V      p.80

          .         .         .         .         .         .       g.14246
 TGGTCCCAGGACAGCTTTGGCCGCTGCCAGCTTGCAGGCTATGGATTTTGCCATGTGCCC       c.300
 W  S  Q  D  S  F  G  R  C  Q  L  A  G  Y  G  F  C  H  V  P         p.100

          .         .         .         .         .         .       g.14306
 AGTAGCCCGGGCACCCACCAGCTGGCCTGCCCCACGTGGCGGCCCCTGGGCAGTTGGCGA       c.360
 S  S  P  G  T  H  Q  L  A  C  P  T  W  R  P  L  G  S  W  R         p.120

          .         .         .         .         .         .       g.14366
 GAACAGTTGGCACGGGCTTTCGTGGGTGGTGGGCCGCAGCTGCTGCATGGGGACACCATC       c.420
 E  Q  L  A  R  A  F  V  G  G  G  P  Q  L  L  H  G  D  T  I         p.140

          .         .         .         .         .         .       g.14426
 TACAGTGGGGCCGACCGCTATCGCCTGCACACAGCTGCTGGTGGCACCGTGCACCTGGAG       c.480
 Y  S  G  A  D  R  Y  R  L  H  T  A  A  G  G  T  V  H  L  E         p.160

          .         .         .         .                           g.14474
 ATCGGCCTGCTGCTCCGCAACTTCGACCGCTACGGCGTGGAGTGCTGA                   c.528
 I  G  L  L  L  R  N  F  D  R  Y  G  V  E  C  X                     p.175

          .         .         .         .         .         .       g.14534
 gggactctgcctccaacgtcaccaccatccacaccccggacacccagtgatgggggagga       c.*60

          .         .         .         .         .         .       g.14594
 tggcacagtggtcaagagcacagactctagagactgtcagagctgaccccagctaaggca       c.*120

          .         .         .         .         .         .       g.14654
 tggcaccgcttctgtcctttctaggacctcggggtccctctgggcccagtttccctatct       c.*180

          .         .         .         .         .         .       g.14714
 gtaaattggggacagtaaatgtatggggtcgcagggtgttgagtgacaggaggctgctta       c.*240

          .         .         .         .                           g.14757
 gccacatgggaggtgctcagtaaaggagagcaattcttacagg                        c.*283

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The B9 protein domain 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.