barrier to autointegration factor 1 (BANF1) - coding DNA reference sequence

(used for variant description)

(last modified January 20, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_003860.3 in the BANF1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_031874.1, covering BANF1 transcript NM_003860.3. Transcript variant-2 (NM_001143985.1) uses an alternative splice site in exon 1, shortening the 5' UTR but encoding the same protein. The promoter/transcription start overlaps with that of the EIF1AD gene.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 ccagtgttcccagttcccaccagtccaa       c.-481

 .         .         .         .         .         .                g.5088
 ctgcgaggagtgcgacgtgagtctgagtctgatccctccgaaaaccgtacttccggcgct       c.-421
                      transcription start site EIF1AD gene  ^ 

 .         .         .         .         .         .                g.5148
 gtctcggaggcctcccgtcccctcccttgtccgtcttctaactcttccccacgccaggtc       c.-361

 .         .         .         .         .         .                g.5208
 cgtcaagcctaagtccttgagttccgggtccgggcagcagagaaaggaagtcctctccct       c.-301

 .         .         .         .         .         .                g.5268
 ggaggcctatctccctcagaactgcgcgagaagcgagaccttagaaggcagggcttcccg       c.-241

 .         .         .         .         .         .                g.5328
 cgaaggaccggaaaggagcgcctactaaggacgccgtcgaggtccggggcgcctcaactc       c.-181

 .         .         .         .         .         .                g.5388
 tatagctctaactggctagaagtgcccaacgtggaatgtttcttttttaaaggcggctct       c.-121

 .         .         .         .         .       /    .                g.5448
 tgaagcgacccggaagcggaagtggaagaaagttctagtggcttgag / gtatccgcaggag       c.-61
                                                 ^  alternative splice site exon 1

 .         .         .         .         .    | 02    .             g.6172
 cggccgggtggcgggaggaaccgttacgggaactgaagttgcgg | attaagcctgatcaag    c.-1

          .         .         .         .         .         .       g.6232
 ATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTG       c.60
 M  T  T  S  Q  K  H  R  D  F  V  A  E  P  M  G  E  K  P  V         p.20

          .         .         .         .         .         .       g.6292
 GGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGAC       c.120
 G  S  L  A  G  I  G  E  V  L  G  K  K  L  E  E  R  G  F  D         p.40

     | 03    .         .         .         .         .         .    g.6604
 AAG | GCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGG    c.180
 K   | A  Y  V  V  L  G  Q  F  L  V  L  K  K  D  E  D  L  F  R      p.60

          .         .         .         .         .         .       g.6664
 GAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGC       c.240
 E  W  L  K  D  T  C  G  A  N  A  K  Q  S  R  D  C  F  G  C         p.80

          .         .         .                                     g.6694
 CTTCGAGAGTGGTGCGACGCCTTCTTGTGA                                     c.270
 L  R  E  W  C  D  A  F  L  X                                       p.89

          .         .         .         .         .         .       g.6754
 tgctctctgggaagctctcaatccccagccctcatccagagtttgcagccgagtagggac       c.*60

          .         .         .         .         .         .       g.6814
 tcctcccctgtcctctacgaaggaaaagattgctattgtcgtactcacctccgacgtact       c.*120

          .         .         .         .         .         .       g.6874
 ccggggtcttttgggagttttctcccctaaccatttcaacttttttttggattctcgctc       c.*180

          .         .         .         .         .         .       g.6934
 ttgcatgcctcccccgtcctttttcccttgccagttccctggtgacagttaccagctttc       c.*240

          .         .         .         .         .         .       g.6994
 ctgaatggattcccggccccatccctcacccccaccctcactttcaatccgtttgatacc       c.*300

          .         .         .         .         .         .       g.7054
 atttggctccttttttggcagaacagtcactgtccttgtaaagttttttagatcaataaa       c.*360

          .                                                         g.7068
 gtcagtggctttca                                                     c.*374

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Barrier to autointegration factor 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.