basic helix-loop-helix family, member a9 (BHLHA9) - coding DNA reference sequence

(used for variant description)

(last modified May 24, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_001164405.1 in the BHLHA9 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_042055.1, covering BHLHA9 transcript NM_001164405.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATGCTGCGGGGCGCGCCAGGACTAGGCCTCACGGCGCGGAAGGGGGCCGAGGACTCTGCG       c.60
 M  L  R  G  A  P  G  L  G  L  T  A  R  K  G  A  E  D  S  A         p.20

          .         .         .         .         .         .       g.120
 GAGGACTTGGGGGGCCCCTGCCCCGAGCCCGGGGGCGATTCGGGGGTGCTGGGGGCGAAC       c.120
 E  D  L  G  G  P  C  P  E  P  G  G  D  S  G  V  L  G  A  N         p.40

          .         .         .         .         .         .       g.180
 GGCGCTTCCTGCAGCCGGGGCGAGGCGGAGGAGCCGGCGGGCAGGAGGCGCGCGCGGCCG       c.180
 G  A  S  C  S  R  G  E  A  E  E  P  A  G  R  R  R  A  R  P         p.60

          .         .         .         .         .         .       g.240
 GTGCGGTCCAAGGCGCGGCGCATGGCCGCCAACGTGCGGGAGCGCAAGCGCATCCTAGAC       c.240
 V  R  S  K  A  R  R  M  A  A  N  V  R  E  R  K  R  I  L  D         p.80

          .         .         .         .         .         .       g.300
 TACAACGAGGCCTTCAACGCGCTGCGCCGGGCGCTGCGGCACGACCTGGGCGGCAAGAGG       c.300
 Y  N  E  A  F  N  A  L  R  R  A  L  R  H  D  L  G  G  K  R         p.100

          .         .         .         .         .         .       g.360
 CTCTCCAAGATCGCCACGCTGCGCAGGGCCATCCACCGCATCGCCGCGCTCTCCCTGGTC       c.360
 L  S  K  I  A  T  L  R  R  A  I  H  R  I  A  A  L  S  L  V         p.120

          .         .         .         .         .         .       g.420
 CTGCGCGCCAGCCCCGCGCCCCGCGGGCCCTGCGGACACCTGGAGTGCCACGGCCCGGCC       c.420
 L  R  A  S  P  A  P  R  G  P  C  G  H  L  E  C  H  G  P  A         p.140

          .         .         .         .         .         .       g.480
 GCGCGCGGGGACACCGGGGACACAGGCGCCAGCCCCCCGCCGCCTGCAGGGCCCAGCCTC       c.480
 A  R  G  D  T  G  D  T  G  A  S  P  P  P  P  A  G  P  S  L         p.160

          .         .         .         .         .         .       g.540
 GCGCGCCCAGACGCCGCCCGCCCCTCGGTGCCGTCCGCGCCCCGCTGCGCCTCGTGCCCC       c.540
 A  R  P  D  A  A  R  P  S  V  P  S  A  P  R  C  A  S  C  P         p.180

          .         .         .         .         .         .       g.600
 CCGCACGCGCCCCTGGCACGGCCCAGTGCGGTGGCCGAGGGGCCGGGCCTAGCACAGGCC       c.600
 P  H  A  P  L  A  R  P  S  A  V  A  E  G  P  G  L  A  Q  A         p.200

          .         .         .         .         .         .       g.660
 TCCGGGGGAAGCTGGCGCCGCTGTCCGGGGGCTTCCTCTGCCGGGCCGCCTCCCTGGCCG       c.660
 S  G  G  S  W  R  R  C  P  G  A  S  S  A  G  P  P  P  W  P         p.220

          .         .         .         .                           g.708
 CGGGGCTACCTGCGATCCGCCCCCGGGATGGGCCATCCGCGCTCCTGA                   c.708
 R  G  Y  L  R  S  A  P  G  M  G  H  P  R  S  X                     p.235

 

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Basic helix-loop-helix family, member a9 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center