biogenesis of lysosomal organelles complex-1, subunit 1 (BLOC1S1) - coding DNA reference sequence

(used for variant description)

(last modified April 3, 2026)

This file was created to facilitate the description of sequence variants on transcript NM_001487.3 in the BLOC1S1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering BLOC1S1 transcript NM_001487.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5018
                                           acacagcggtcacgtgac       c.-1

          .         .         .         .         .         .       g.5078
 ATGGCCCCGGGGAGCCGAGGTGAGCGTTCCAGCTTCCGGAGCCGGAGGGGGCCCGGCGTA       c.60
 M  A  P  G  S  R  G  E  R  S  S  F  R  S  R  R  G  P  G  V         p.20

          .         .         .         .         .         .       g.5138
 CCCAGCCCCCAGCCCGACGTGACCATGCTGTCCCGCCTCCTAAAAGAACACCAGGCCAAG       c.120
 P  S  P  Q  P  D  V  T  M  L  S  R  L  L  K  E  H  Q  A  K         p.40

          .         .      | 02  .         .         .         .    g.5934
 CAGAATGAACGCAAGGAGCTGCAGG | AAAAGAGGAGGCGAGAGGCTATCACTGCAGCGACC    c.180
 Q  N  E  R  K  E  L  Q  E |   K  R  R  R  E  A  I  T  A  A  T      p.60

          .         .         .         | 03         .         .    g.8079
 TGCCTGACAGAAGCTTTGGTGGATCACCTCAATGTGGG | TGTGGCCCAGGCCTACATGAAC    c.240
 C  L  T  E  A  L  V  D  H  L  N  V  G  |  V  A  Q  A  Y  M  N      p.80

          .         .         .         .         .         .       g.8139
 CAGAGAAAGCTGGACCATGAGGTGAAGACCCTACAGGTCCAGGCTGCCCAATTTGCCAAG       c.300
 Q  R  K  L  D  H  E  V  K  T  L  Q  V  Q  A  A  Q  F  A  K         p.100

          .         .         .         .         .  | 04      .    g.8474
 CAGACAGGCCAGTGGATCGGAATGGTGGAGAACTTCAACCAGGCACTCAAG | GAAATTGGG    c.360
 Q  T  G  Q  W  I  G  M  V  E  N  F  N  Q  A  L  K   | E  I  G      p.120

          .         .         .         .         .         .       g.8534
 GATGTGGAGAACTGGGCTCGGAGCATCGAGCTGGACATGCGCACCATTGCCACTGCACTG       c.420
 D  V  E  N  W  A  R  S  I  E  L  D  M  R  T  I  A  T  A  L         p.140

          .         .         .         .                           g.8576
 GAATATGTCTACAAAGGGCAGCTGCAGTCTGCCCCTTCCTAG                         c.462
 E  Y  V  Y  K  G  Q  L  Q  S  A  P  S  X                           p.153

          .         .         .         .         .         .       g.8636
 cccctgttccctcccccaaccctatccctcctacctcacccgcagggggaaggagggagg       c.*60

          .         .         .                                     g.8674
 ctgacaagccttgaataaaacacaagcctccgtttctc                             c.*98

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Biogenesis of lysosomal organelles complex-1, subunit 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.