breast cancer 1, early onset (BRCA1) - coding DNA reference sequence

(used for variant description)

(last modified November 11, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_007294.3 in the BRCA1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_005905.2, covering BRCA1 transcript NM_007294.3.
NOTE: exon numbering skips exon 4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5052
         gtaccttgatttcgtattctgagaggctgctgcttagcggtagccccttggt       c.-181

 .         .         .         .         .         .                g.5112
 ttccgtggcaacggaaaagcgcgggaattacagataaattaaaactgcgactgcgcggcg       c.-121

 .         .         .         .         .         .                g.5172
 tgagctcgctgagacttcctggacgggggacaggctgtggggtttctcagataactgggc       c.-61

 .         .         .         .         . | 02       .             g.6387
 ccctgcgctcaggaggccttcaccctctgctctgggtaaag | ttcattggaacagaaagaa    c.-1

          .         .         .         .         .         .       g.6447
 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAA       c.60
 M  D  L  S  A  L  R  V  E  E  V  Q  N  V  I  N  A  M  Q  K         p.20

          .         . | 03       .         .         .         .    g.14744
 ATCTTAGAGTGTCCCATCTG | TCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGAC    c.120
 I  L  E  C  P  I  C  |  L  E  L  I  K  E  P  V  S  T  K  C  D      p.40

          .     | 05   .         .         .         .         .    g.23996
 CACATATTTTGCAA | ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAG    c.180
 H  I  F  C  K  |  F  C  M  L  K  L  L  N  Q  K  K  G  P  S  Q      p.60

          .         .         .   | 06     .         .         .    g.25555
 TGTCCTTTATGTAAGAATGATATAACCAAAAG | GAGCCTACAAGAAAGTACGAGATTTAGT    c.240
 C  P  L  C  K  N  D  I  T  K  R  |  S  L  Q  E  S  T  R  F  S      p.80

          .         .         .         .         .         .       g.25615
 CAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAG       c.300
 Q  L  V  E  E  L  L  K  I  I  C  A  F  Q  L  D  T  G  L  E         p.100

   | 07      .         .         .         .         .         .    g.26281
 T | ATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGAT    c.360
 Y |   A  N  S  Y  N  F  A  K  K  E  N  N  S  P  E  H  L  K  D      p.120

          .         .         .         .         .         .       g.26341
 GAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGT       c.420
 E  V  S  I  I  Q  S  M  G  Y  R  N  R  A  K  R  L  L  Q  S         p.140

          .         .  | 08      .         .         .         .    g.30642
 GAACCCGAAAATCCTTCCTTG | CAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGA    c.480
 E  P  E  N  P  S  L   | Q  E  T  S  L  S  V  Q  L  S  N  L  G      p.160

          .         .         .         .         .         .       g.30702
 ACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATT       c.540
 T  V  R  T  L  R  T  K  Q  R  I  Q  P  Q  K  T  S  V  Y  I         p.180

         | 09.         .         .         .         .    | 10    . g.34568
 GAATTGG | GATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAG | TGTGGGA c.600
 E  L  G |   S  D  S  S  E  D  T  V  N  K  A  T  Y  C  S  |  V  G   p.200

          .         .         .         .         .         .       g.34628
 GATCAAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCT       c.660
 D  Q  E  L  L  Q  I  T  P  Q  G  T  R  D  E  I  S  L  D  S         p.220

          . | 11       .         .         .         .         .    g.35673
 GCAAAAAAGG | CTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAA    c.720
 A  K  K  A |   A  C  E  F  S  E  T  D  V  T  N  T  E  H  H  Q      p.240

          .         .         .         .         .         .       g.35733
 CCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAG       c.780
 P  S  N  N  D  L  N  T  T  E  K  R  A  A  E  R  H  P  E  K         p.260

          .         .         .         .         .         .       g.35793
 TATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCC       c.840
 Y  Q  G  S  S  V  S  N  L  H  V  E  P  C  G  T  N  T  H  A         p.280

          .         .         .         .         .         .       g.35853
 AGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAA       c.900
 S  S  L  Q  H  E  N  S  S  L  L  L  T  K  D  R  M  N  V  E         p.300

          .         .         .         .         .         .       g.35913
 AAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGA       c.960
 K  A  E  F  C  N  K  S  K  Q  P  G  L  A  R  S  Q  H  N  R         p.320

          .         .         .         .         .         .       g.35973
 TGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTA       c.1020
 W  A  G  S  K  E  T  C  N  D  R  R  T  P  S  T  E  K  K  V         p.340

          .         .         .         .         .         .       g.36033
 GATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGAAACTGCCATGC       c.1080
 D  L  N  A  D  P  L  C  E  R  K  E  W  N  K  Q  K  L  P  C         p.360

          .         .         .         .         .         .       g.36093
 TCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAG       c.1140
 S  E  N  P  R  D  T  E  D  V  P  W  I  T  L  N  S  S  I  Q         p.380

          .         .         .         .         .         .       g.36153
 AAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGAT       c.1200
 K  V  N  E  W  F  S  R  S  D  E  L  L  G  S  D  D  S  H  D         p.400

          .         .         .         .         .         .       g.36213
 GGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGAT       c.1260
 G  E  S  E  S  N  A  K  V  A  D  V  L  D  V  L  N  E  V  D         p.420

          .         .         .         .         .         .       g.36273
 GAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTA       c.1320
 E  Y  S  G  S  S  E  K  I  D  L  L  A  S  D  P  H  E  A  L         p.440

          .         .         .         .         .         .       g.36333
 ATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAGACAAAATA       c.1380
 I  C  K  S  E  R  V  H  S  K  S  V  E  S  N  I  E  D  K  I         p.460

          .         .         .         .         .         .       g.36393
 TTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAAT       c.1440
 F  G  K  T  Y  R  K  K  A  S  L  P  N  L  S  H  V  T  E  N         p.480

          .         .         .         .         .         .       g.36453
 CTAATTATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAAT       c.1500
 L  I  I  G  A  F  V  T  E  P  Q  I  I  Q  E  R  P  L  T  N         p.500

          .         .         .         .         .         .       g.36513
 AAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAA       c.1560
 K  L  K  R  K  R  R  P  T  S  G  L  H  P  E  D  F  I  K  K         p.520

          .         .         .         .         .         .       g.36573
 GCAGATTTGGCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAG       c.1620
 A  D  L  A  V  Q  K  T  P  E  M  I  N  Q  G  T  N  Q  T  E         p.540

          .         .         .         .         .         .       g.36633
 CAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAACAAAAGGTGAT       c.1680
 Q  N  G  Q  V  M  N  I  T  N  S  G  H  E  N  K  T  K  G  D         p.560

          .         .         .         .         .         .       g.36693
 TCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTC       c.1740
 S  I  Q  N  E  K  N  P  N  P  I  E  S  L  E  K  E  S  A  F         p.580

          .         .         .         .         .         .       g.36753
 AAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATC       c.1800
 K  T  K  A  E  P  I  S  S  S  I  S  N  M  E  L  E  L  N  I         p.600

          .         .         .         .         .         .       g.36813
 CACAATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATT       c.1860
 H  N  S  K  A  P  K  K  N  R  L  R  R  K  S  S  T  R  H  I         p.620

          .         .         .         .         .         .       g.36873
 CATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAA       c.1920
 H  A  L  E  L  V  V  S  R  N  L  S  P  P  N  C  T  E  L  Q         p.640

          .         .         .         .         .         .       g.36933
 ATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTC       c.1980
 I  D  S  C  S  S  S  E  E  I  K  K  K  K  Y  N  Q  M  P  V         p.660

          .         .         .         .         .         .       g.36993
 AGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAG       c.2040
 R  H  S  R  N  L  Q  L  M  E  G  K  E  P  A  T  G  A  K  K         p.680

          .         .         .         .         .         .       g.37053
 AGTAACAAGCCAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTG       c.2100
 S  N  K  P  N  E  Q  T  S  K  R  H  D  S  D  T  F  P  E  L         p.700

          .         .         .         .         .         .       g.37113
 AAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAA       c.2160
 K  L  T  N  A  P  G  S  F  T  K  C  S  N  T  S  E  L  K  E         p.720

          .         .         .         .         .         .       g.37173
 TTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTG       c.2220
 F  V  N  P  S  L  P  R  E  E  K  E  E  K  L  E  T  V  K  V         p.740

          .         .         .         .         .         .       g.37233
 TCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACT       c.2280
 S  N  N  A  E  D  P  K  D  L  M  L  S  G  E  R  V  L  Q  T         p.760

          .         .         .         .         .         .       g.37293
 GAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAG       c.2340
 E  R  S  V  E  S  S  S  I  S  L  V  P  G  T  D  Y  G  T  Q         p.780

          .         .         .         .         .         .       g.37353
 GAAAGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAA       c.2400
 E  S  I  S  L  L  E  V  S  T  L  G  K  A  K  T  E  P  N  K         p.800

          .         .         .         .         .         .       g.37413
 TGTGTGAGTCAGTGTGCAGCATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAA       c.2460
 C  V  S  Q  C  A  A  F  E  N  P  K  G  L  I  H  G  C  S  K         p.820

          .         .         .         .         .         .       g.37473
 GATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGT       c.2520
 D  N  R  N  D  T  E  G  F  K  Y  P  L  G  H  E  V  N  H  S         p.840

          .         .         .         .         .         .       g.37533
 CGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGCAGAATACA       c.2580
 R  E  T  S  I  E  M  E  E  S  E  L  D  A  Q  Y  L  Q  N  T         p.860

          .         .         .         .         .         .       g.37593
 TTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAATCCAGGAAATGCAGAAGAG       c.2640
 F  K  V  S  K  R  Q  S  F  A  P  F  S  N  P  G  N  A  E  E         p.880

          .         .         .         .         .         .       g.37653
 GAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACT       c.2700
 E  C  A  T  F  S  A  H  S  G  S  L  K  K  Q  S  P  K  V  T         p.900

          .         .         .         .         .         .       g.37713
 TTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTA       c.2760
 F  E  C  E  Q  K  E  E  N  Q  G  K  N  E  S  N  I  K  P  V         p.920

          .         .         .         .         .         .       g.37773
 CAGACAGTTAATATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGAT       c.2820
 Q  T  V  N  I  T  A  G  F  P  V  V  G  Q  K  D  K  P  V  D         p.940

          .         .         .         .         .         .       g.37833
 AATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGC       c.2880
 N  A  K  C  S  I  K  G  G  S  R  F  C  L  S  S  Q  F  R  G         p.960

          .         .         .         .         .         .       g.37893
 AACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATA       c.2940
 N  E  T  G  L  I  T  P  N  K  H  G  L  L  Q  N  P  Y  R  I         p.980

          .         .         .         .         .         .       g.37953
 CCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAG       c.3000
 P  P  L  F  P  I  K  S  F  V  K  T  K  C  K  K  N  L  L  E         p.1000

          .         .         .         .         .         .       g.38013
 GAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCA       c.3060
 E  N  F  E  E  H  S  M  S  P  E  R  E  M  G  N  E  N  I  P         p.1020

          .         .         .         .         .         .       g.38073
 AGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGC       c.3120
 S  T  V  S  T  I  S  R  N  N  I  R  E  N  V  F  K  E  A  S         p.1040

          .         .         .         .         .         .       g.38133
 TCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAA       c.3180
 S  S  N  I  N  E  V  G  S  S  T  N  E  V  G  S  S  I  N  E         p.1060

          .         .         .         .         .         .       g.38193
 ATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGTAGAAACAGAGGGCCAAAATTG       c.3240
 I  G  S  S  D  E  N  I  Q  A  E  L  G  R  N  R  G  P  K  L         p.1080

          .         .         .         .         .         .       g.38253
 AATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGA       c.3300
 N  A  M  L  R  L  G  V  L  Q  P  E  V  Y  K  Q  S  L  P  G         p.1100

          .         .         .         .         .         .       g.38313
 AGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTT       c.3360
 S  N  C  K  H  P  E  I  K  K  Q  E  Y  E  E  V  V  Q  T  V         p.1120

          .         .         .         .         .         .       g.38373
 AATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGT       c.3420
 N  T  D  F  S  P  Y  L  I  S  D  N  L  E  Q  P  M  G  S  S         p.1140

          .         .         .         .         .         .       g.38433
 CATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAG       c.3480
 H  A  S  Q  V  C  S  E  T  P  D  D  L  L  D  D  G  E  I  K         p.1160

          .         .         .         .         .         .       g.38493
 GAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGC       c.3540
 E  D  T  S  F  A  E  N  D  I  K  E  S  S  A  V  F  S  K  S         p.1180

          .         .         .         .         .         .       g.38553
 GTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAG       c.3600
 V  Q  K  G  E  L  S  R  S  P  S  P  F  T  H  T  H  L  A  Q         p.1200

          .         .         .         .         .         .       g.38613
 GGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGAT       c.3660
 G  Y  R  R  G  A  K  K  L  E  S  S  E  E  N  L  S  S  E  D         p.1220

          .         .         .         .         .         .       g.38673
 GAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAG       c.3720
 E  E  L  P  C  F  Q  H  L  L  F  G  K  V  N  N  I  P  S  Q         p.1240

          .         .         .         .         .         .       g.38733
 TCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTA       c.3780
 S  T  R  H  S  T  V  A  T  E  C  L  S  K  N  T  E  E  N  L         p.1260

          .         .         .         .         .         .       g.38793
 TTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCT       c.3840
 L  S  L  K  N  S  L  N  D  C  S  N  Q  V  I  L  A  K  A  S         p.1280

          .         .         .         .         .         .       g.38853
 CAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGC       c.3900
 Q  E  H  H  L  S  E  E  T  K  C  S  A  S  L  F  S  S  Q  C         p.1300

          .         .         .         .         .         .       g.38913
 AGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCT       c.3960
 S  E  L  E  D  L  T  A  N  T  N  T  Q  D  P  F  L  I  G  S         p.1320

          .         .         .         .         .         .       g.38973
 TCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTG       c.4020
 S  K  Q  M  R  H  Q  S  E  S  Q  G  V  G  L  S  D  K  E  L         p.1340

          .         .         .         .         .         .       g.39033
 GTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGC       c.4080
 V  S  D  D  E  E  R  G  T  G  L  E  E  N  N  Q  E  E  Q  S         p.1360

          .       | 12 .         .         .         .         .    g.39495
 ATGGATTCAAACTTAG | GTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAA    c.4140
 M  D  S  N  L  G |   E  A  A  S  G  C  E  S  E  T  S  V  S  E      p.1380

          .         .         .         .      | 13  .         .    g.47923
 GACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAG | CAGAGGGATACCATG    c.4200
 D  C  S  G  L  S  S  Q  S  D  I  L  T  T  Q   | Q  R  D  T  M      p.1400

          .         .         .         .         .         .       g.47983
 CAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAG       c.4260
 Q  H  N  L  I  K  L  Q  Q  E  M  A  E  L  E  A  V  L  E  Q         p.1420

          .         .         .         .         .         .       g.48043
 CATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAG       c.4320
 H  G  S  Q  P  S  N  S  Y  P  S  I  I  S  D  S  S  A  L  E         p.1440

          .         .         .        | 14.         .         .    g.53892
 GACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAG | CAGTATTAACTTCACAGAAAAGT    c.4380
 D  L  R  N  P  E  Q  S  T  S  E  K  A |   V  L  T  S  Q  K  S      p.1460

          .         .         .         .         .         .       g.53952
 AGTGAATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCT       c.4440
 S  E  Y  P  I  S  Q  N  P  E  G  L  S  A  D  K  F  E  V  S         p.1480

          .         .         .         .     | 15   .         .    g.55978
 GCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAG | GTCATCCCCTTCTAAA    c.4500
 A  D  S  S  T  S  K  N  K  E  P  G  V  E  R  |  S  S  P  S  K      p.1500

          .         .         .         .         .         .       g.56038
 TGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGA       c.4560
 C  P  S  L  D  D  R  W  Y  M  H  S  C  S  G  S  L  Q  N  R         p.1520

          .         .         .         .         .         .       g.56098
 AACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAA       c.4620
 N  Y  P  S  Q  E  E  L  I  K  V  V  D  V  E  E  Q  Q  L  E         p.1540

          .         .         .         .         .      | 16  .    g.59250
 GAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG | AGGGA    c.4680
 E  S  G  P  H  D  L  T  E  T  S  Y  L  P  R  Q  D  L  E |   G      p.1560

          .         .         .         .         .         .       g.59310
 ACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCT       c.4740
 T  P  Y  L  E  S  G  I  S  L  F  S  D  D  P  E  S  D  P  S         p.1580

          .         .         .         .         .         .       g.59370
 GAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTG       c.4800
 E  D  R  A  P  E  S  A  R  V  G  N  I  P  S  S  T  S  A  L         p.1600

          .         .         .         .         .         .       g.59430
 AAAGTTCCCCAATTGAAAGTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACT       c.4860
 K  V  P  Q  L  K  V  A  E  S  A  Q  S  P  A  A  A  H  T  T         p.1620

          .         .         .         .         .         .       g.59490
 GATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACA       c.4920
 D  T  A  G  Y  N  A  M  E  E  S  V  S  R  E  K  P  E  L  T         p.1640

          .         .         .         .         .         .       g.59550
 GCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAA       c.4980
 A  S  T  E  R  V  N  K  R  M  S  M  V  V  S  G  L  T  P  E         p.1660

        | 17 .         .         .         .         .         .    g.62842
 GAATTT | ATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATT    c.5040
 E  F   | M  L  V  Y  K  F  A  R  K  H  H  I  T  L  T  N  L  I      p.1680

          .         .         .     | 18   .         .         .    g.66558
 ACTGAAGAGACTACTCATGTTGTTATGAAAACAG | ATGCTGAGTTTGTGTGTGAACGGACA    c.5100
 T  E  E  T  T  H  V  V  M  K  T  D |   A  E  F  V  C  E  R  T      p.1700

          .         .         .         .         .   | 19     .    g.67118
 CTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT | GGGTGACC    c.5160
 L  K  Y  F  L  G  I  A  G  G  K  W  V  V  S  Y  F  W |   V  T      p.1720

          .         .         .    | 20    .         .         .    g.73375
 CAGTCTATTAAAGAAAGAAAAATGCTGAATGAG | CATGATTTTGAAGTCAGAGGAGATGTG    c.5220
 Q  S  I  K  E  R  K  M  L  N  E   | H  D  F  E  V  R  G  D  V      p.1740

          .         .         .         .         .        | 21.    g.79369
 GTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAG | ATC    c.5280
 V  N  G  R  N  H  Q  G  P  K  R  A  R  E  S  Q  D  R  K   | I      p.1760

          .         .         .         .         .   | 22     .    g.81297
 TTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAG | ATCAACTG    c.5340
 F  R  G  L  E  I  C  C  Y  G  P  F  T  N  M  P  T  D |   Q  L      p.1780

          .         .         .         .         .         .       g.81357
 GAATGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTT       c.5400
 E  W  M  V  Q  L  C  G  A  S  V  V  K  E  L  S  S  F  T  L         p.1800

        | 23 .         .         .         .         .         .    g.82834
 GGCACA | GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGC    c.5460
 G  T   | G  V  H  P  I  V  V  V  Q  P  D  A  W  T  E  D  N  G      p.1820

         | 24.         .         .         .         .         .    g.84734
 TTCCATG | CAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGAC    c.5520
 F  H  A |   I  G  Q  M  C  E  A  P  V  V  T  R  E  W  V  L  D      p.1840

          .         .         .         .         .         .       g.84794
 AGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCAC       c.5580
 S  V  A  L  Y  Q  C  Q  E  L  D  T  Y  L  I  P  Q  I  P  H         p.1860

          .                                                         g.84806
 AGCCACTACTGA                                                       c.5592
 S  H  Y  X                                                         p.1863

          .         .         .         .         .         .       g.84866
 ctgcagccagccacaggtacagagccacaggaccccaagaatgagcttacaaagtggcct       c.*60

          .         .         .         .         .         .       g.84926
 ttccaggccctgggagctcctctcactcttcagtccttctactgtcctggctactaaata       c.*120

          .         .         .         .         .         .       g.84986
 ttttatgtacatcagcctgaaaaggacttctggctatgcaagggtcccttaaagattttc       c.*180

          .         .         .         .         .         .       g.85046
 tgcttgaagtctcccttggaaatctgccatgagcacaaaattatggtaatttttcacctg       c.*240

          .         .         .         .         .         .       g.85106
 agaagattttaaaaccatttaaacgccaccaattgagcaagatgctgattcattatttat       c.*300

          .         .         .         .         .         .       g.85166
 cagccctattctttctattcaggctgttgttggcttagggctggaagcacagagtggctt       c.*360

          .         .         .         .         .         .       g.85226
 ggcctcaagagaatagctggtttccctaagtttacttctctaaaaccctgtgttcacaaa       c.*420

          .         .         .         .         .         .       g.85286
 ggcagagagtcagacccttcaatggaaggagagtgcttgggatcgattatgtgacttaaa       c.*480

          .         .         .         .         .         .       g.85346
 gtcagaatagtccttgggcagttctcaaatgttggagtggaacattggggaggaaattct       c.*540

          .         .         .         .         .         .       g.85406
 gaggcaggtattagaaatgaaaaggaaacttgaaacctgggcatggtggctcacgcctgt       c.*600

          .         .         .         .         .         .       g.85466
 aatcccagcactttgggaggccaaggtgggcagatcactggaggtcaggagttcgaaacc       c.*660

          .         .         .         .         .         .       g.85526
 agcctggccaacatggtgaaaccccatctctactaaaaatacagaaattagccggtcatg       c.*720

          .         .         .         .         .         .       g.85586
 gtggtggacacctgtaatcccagctactcaggtggctaaggcaggagaatcacttcagcc       c.*780

          .         .         .         .         .         .       g.85646
 cgggaggtggaggttgcagtgagccaagatcataccacggcactccagcctgggtgacag       c.*840

          .         .         .         .         .         .       g.85706
 tgagactgtggctcaaaaaaaaaaaaaaaaaaaggaaaatgaaactagaagagatttcta       c.*900

          .         .         .         .         .         .       g.85766
 aaagtctgagatatatttgctagatttctaaagaatgtgttctaaaacagcagaagattt       c.*960

          .         .         .         .         .         .       g.85826
 tcaagaaccggtttccaaagacagtcttctaattcctcattagtaataagtaaaatgttt       c.*1020

          .         .         .         .         .         .       g.85886
 attgttgtagctctggtatataatccattcctcttaaaatataagacctctggcatgaat       c.*1080

          .         .         .         .         .         .       g.85946
 atttcatatctataaaatgacagatcccaccaggaaggaagctgttgctttctttgaggt       c.*1140

          .         .         .         .         .         .       g.86006
 gatttttttcctttgctccctgttgctgaaaccatacagcttcataaataattttgcttg       c.*1200

          .         .         .         .         .         .       g.86066
 ctgaaggaagaaaaagtgtttttcataaacccattatccaggactgtttatagctgttgg       c.*1260

          .         .         .         .         .         .       g.86126
 aaggactaggtcttccctagcccccccagtgtgcaagggcagtgaagacttgattgtaca       c.*1320

          .         .         .         .         .         .       g.86186
 aaatacgttttgtaaatgttgtgctgttaacactgcaaataaacttggtagcaaacactt       c.*1380

                                                                    g.86189
 cca                                                                c.*1383

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Breast cancer 1, early onset protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center