biotinidase (BTD) - coding DNA reference sequence

(used for variant description)

(last modified June 29, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_000060.2 in the BTD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008019.1, covering BTD transcript NM_000060.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5043
                  agattgctgcctatgcaaagcaggtaagaagccgaactctgag       c.-61

 .         .         .         .         .         .                g.5103
 gcctctcgccattgtctccgagtcggccagctggagcgttttcggggctgtaaagggaga       c.-1

          .         .         .         .     | 02   .         .    g.38692
 ATGGCGCATGCGCATATTCAGGGCGGAAGGCGCGCTAAGAGCAG | ATTTGTGGTCTGCATT    c.60
 M  A  H  A  H  I  Q  G  G  R  R  A  K  S  R  |  F  V  V  C  I      p.20

          .         .         .         .         .         .       g.38752
 ATGTCTGGAGCCAGAAGTAAGCTTGCTCTTTTCCTCTGCGGCTGTTACGTGGTTGCCCTG       c.120
 M  S  G  A  R  S  K  L  A  L  F  L  C  G  C  Y  V  V  A  L         p.40

          .         .         .         .         .         .       g.38812
 GGAGCCCACACCGGGGAGGAGAGCGTGGCTGACCATCACGAGGCTGAATATTATGTGGCT       c.180
 G  A  H  T  G  E  E  S  V  A  D  H  H  E  A  E  Y  Y  V  A         p.60

          .         .         .         .         .         .       g.38872
 GCCGTGTATGAGCATCCATCCATCCTGAGTCTGAACCCTCTGGCTCTCATCAGCCGCCAA       c.240
 A  V  Y  E  H  P  S  I  L  S  L  N  P  L  A  L  I  S  R  Q         p.80

          .         .         .         .         .         .       g.38932
 GAGGCCTTGGAGCTCATGAACCAGAACCTTGACATCTATGAACAGCAAGTGATGACTGCA       c.300
 E  A  L  E  L  M  N  Q  N  L  D  I  Y  E  Q  Q  V  M  T  A         p.100

           | 03        .         .         .         .         .    g.45211
 GCCCAAAAG | GATGTACAGATTATAGTGTTTCCAGAAGATGGCATTCATGGATTCAACTTT    c.360
 A  Q  K   | D  V  Q  I  I  V  F  P  E  D  G  I  H  G  F  N  F      p.120

          .         .         .         .         .         .       g.45271
 ACAAGAACATCCATTTATCCATTTTTGGACTTCATGCCGTCTCCCCAGGTGGTCAGGTGG       c.420
 T  R  T  S  I  Y  P  F  L  D  F  M  P  S  P  Q  V  V  R  W         p.140

          .         .         .          | 04        .         .    g.47589
 AACCCATGCCTGGAGCCTCACCGCTTCAATGACACAGAG | GTGCTCCAGCGCCTGAGTTGT    c.480
 N  P  C  L  E  P  H  R  F  N  D  T  E   | V  L  Q  R  L  S  C      p.160

          .         .         .         .         .         .       g.47649
 ATGGCCATCAGGGGAGATATGTTCTTGGTGGCCAATCTTGGGACAAAGGAGCCTTGTCAT       c.540
 M  A  I  R  G  D  M  F  L  V  A  N  L  G  T  K  E  P  C  H         p.180

          .         .         .         .         .         .       g.47709
 AGCAGTGACCCAAGGTGCCCAAAAGATGGGAGATACCAGTTCAACACAAATGTCGTGTTC       c.600
 S  S  D  P  R  C  P  K  D  G  R  Y  Q  F  N  T  N  V  V  F         p.200

          .         .         .         .         .         .       g.47769
 AGCAATAATGGAACCCTTGTTGACCGCTACCGTAAACACAACCTCTACTTTGAGGCAGCA       c.660
 S  N  N  G  T  L  V  D  R  Y  R  K  H  N  L  Y  F  E  A  A         p.220

          .         .         .         .         .         .       g.47829
 TTCGATGTTCCTCTTAAAGTGGATCTCATCACCTTTGATACCCCCTTTGCTGGCAGGTTT       c.720
 F  D  V  P  L  K  V  D  L  I  T  F  D  T  P  F  A  G  R  F         p.240

          .         .         .         .         .         .       g.47889
 GGCATCTTCACATGCTTTGATATATTGTTCTTTGACCCTGCCATCAGAGTCCTCAGAGAC       c.780
 G  I  F  T  C  F  D  I  L  F  F  D  P  A  I  R  V  L  R  D         p.260

          .         .         .         .         .         .       g.47949
 TACAAGGTGAAGCATGTTGTGTACCCAACTGCCTGGATGAACCAGCTCCCACTCTTGGCA       c.840
 Y  K  V  K  H  V  V  Y  P  T  A  W  M  N  Q  L  P  L  L  A         p.280

          .         .         .         .         .         .       g.48009
 GCAATTGAGATTCAGAAAGCTTTTGCTGTTGCCTTTGGCATCAACGTTCTGGCAGCTAAT       c.900
 A  I  E  I  Q  K  A  F  A  V  A  F  G  I  N  V  L  A  A  N         p.300

          .         .         .         .         .         .       g.48069
 GTCCACCACCCAGTTCTGGGGATGACAGGAAGTGGCATACACACCCCTCTGGAGTCCTTT       c.960
 V  H  H  P  V  L  G  M  T  G  S  G  I  H  T  P  L  E  S  F         p.320

          .         .         .         .         .         .       g.48129
 TGGTACCATGACATGGAAAATCCCAAAAGTCACCTTATAATTGCCCAGGTGGCCAAAAAT       c.1020
 W  Y  H  D  M  E  N  P  K  S  H  L  I  I  A  Q  V  A  K  N         p.340

          .         .         .         .         .         .       g.48189
 CCAGTGGGTCTCATTGGTGCAGAGAATGCAACAGGTGAAACGGACCCATCCCATAGTAAG       c.1080
 P  V  G  L  I  G  A  E  N  A  T  G  E  T  D  P  S  H  S  K         p.360

          .         .         .         .         .         .       g.48249
 TTTTTAAAAATTTTGTCAGGCGATCCGTACTGTGAGAAGGATGCTCAGGAAGTCCACTGT       c.1140
 F  L  K  I  L  S  G  D  P  Y  C  E  K  D  A  Q  E  V  H  C         p.380

          .         .         .         .         .         .       g.48309
 GATGAGGCCACCAAGTGGAACGTGAATGCTCCTCCCACATTTCACTCTGAGATGATGTAT       c.1200
 D  E  A  T  K  W  N  V  N  A  P  P  T  F  H  S  E  M  M  Y         p.400

          .         .         .         .         .         .       g.48369
 GACAATTTCACCCTGGTCCCTGTCTGGGGAAAGGAAGGCTATCTCCACGTCTGTTCCAAT       c.1260
 D  N  F  T  L  V  P  V  W  G  K  E  G  Y  L  H  V  C  S  N         p.420

          .         .         .         .         .         .       g.48429
 GGCCTCTGCTGTTATTTACTTTACGAGAGGCCCACCTTATCCAAAGAGCTGTATGCCCTG       c.1320
 G  L  C  C  Y  L  L  Y  E  R  P  T  L  S  K  E  L  Y  A  L         p.440

          .         .         .         .         .         .       g.48489
 GGGGTCTTTGATGGGCTTCACACAGTACATGGCACTTACTACATCCAAGTGTGTGCCCTG       c.1380
 G  V  F  D  G  L  H  T  V  H  G  T  Y  Y  I  Q  V  C  A  L         p.460

          .         .         .         .         .         .       g.48549
 GTCAGGTGTGGGGGTCTTGGCTTCGACACCTGTGGACAGGAAATCACAGAGGCCACGGGG       c.1440
 V  R  C  G  G  L  G  F  D  T  C  G  Q  E  I  T  E  A  T  G         p.480

          .         .         .         .         .         .       g.48609
 ATATTTGAGTTTCACCTGTGGGGCAACTTCAGTACTTCCTATATCTTTCCTTTGTTTCTG       c.1500
 I  F  E  F  H  L  W  G  N  F  S  T  S  Y  I  F  P  L  F  L         p.500

          .         .         .         .         .         .       g.48669
 ACCTCAGGGATGACCCTAGAAGTCCCTGACCAGCTTGGCTGGGAGAATGACCACTATTTC       c.1560
 T  S  G  M  T  L  E  V  P  D  Q  L  G  W  E  N  D  H  Y  F         p.520

          .         .         .         .         .         .       g.48729
 CTGAGGAAAAGTAGGCTGTCCTCTGGGCTGGTGACGGCGGCTCTCTATGGGCGCTTGTAT       c.1620
 L  R  K  S  R  L  S  S  G  L  V  T  A  A  L  Y  G  R  L  Y         p.540

          .                                                         g.48741
 GAGAGGGACTAG                                                       c.1632
 E  R  D  X                                                         p.543

          .         .         .         .         .         .       g.48801
 gaaaagtgtgtggtctgtggggcggactctggccatcatgttgacagccttgcacttcca       c.*60

          .         .         .         .         .         .       g.48861
 caggctacaagccctgggaccatctttctgccttaagggcaggagcccacttctgtggca       c.*120

          .         .         .         .         .         .       g.48921
 ccagattccaccctgggaactgtggaaaaagtaggagaggcagattccctcagtgtcttc       c.*180

          .         .         .         .         .         .       g.48981
 ctcttaaacctcaatcatcgagacattagggggtattttctgttcacatttatctttttc       c.*240

          .         .         .         .         .         .       g.49041
 aagccacatcttcctctaacaaatctctcagtatgcgattggtctcaagctaaaacaaaa       c.*300

          .         .         .                                     g.49071
 ataaatgtcagtttatattttacacatcca                                     c.*330

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Biotinidase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center