chromosome 11 open reading frame 73 (C11orf73) - coding DNA reference sequence

(used for variant description)

(last modified October 25, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_016401.3 in the C11orf73 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering C11orf73 transcript NM_016401.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5058
   aaaaccgggtgtaagccccggaagtacttgttgcctgagcagtgggctgcttaggaag       c.-181

 .         .         .         .         .         .                g.5118
 agaaggtcagagttcgcgggggcagaggcattcttgccgctggcccagtcactatgtagt       c.-121

 .         .         .         .         .         .                g.5178
 ggaggggcagacaccctcccgcaaattctggaaggttcttagtctcgactagggcagtag       c.-61

 .         .         .         .         .         .                g.5238
 ccccaggactcctagtcgccggcttcaggtcactgccggctgaacggagctgccgtcgcc       c.-1

          .         .         . | 02       .         .         .    g.9064
 ATGTTTGGCTGCTTGGTGGCGGGGAGGCTG | GTGCAAACAGCTGCACAGCAAGTGGCAGAG    c.60
 M  F  G  C  L  V  A  G  R  L   | V  Q  T  A  A  Q  Q  V  A  E      p.20

          .         .         .         .         .         .       g.9124
 GATAAATTTGTTTTTGACTTACCTGATTATGAAAGTATCAACCATGTTGTGGTTTTTATG       c.120
 D  K  F  V  F  D  L  P  D  Y  E  S  I  N  H  V  V  V  F  M         p.40

          .         .         .         .         .         .       g.9184
 CTGGGAACAATCCCATTTCCTGAGGGAATGGGAGGATCTGTCTACTTTTCTTATCCTGAT       c.180
 L  G  T  I  P  F  P  E  G  M  G  G  S  V  Y  F  S  Y  P  D         p.60

          .         .         .         .         .         .       g.9244
 TCAAATGGAATGCCAGTATGGCAACTCCTAGGATTTGTCACGAATGGGAAGCCAAGTGCC       c.240
 S  N  G  M  P  V  W  Q  L  L  G  F  V  T  N  G  K  P  S  A         p.80

          .         .         | 03         .         .         .    g.40200
 ATCTTCAAAATTTCAGGTCTTAAATCTG | GAGAAGGAAGCCAACATCCTTTTGGAGCCATG    c.300
 I  F  K  I  S  G  L  K  S  G |   E  G  S  Q  H  P  F  G  A  M      p.100

          .         .         .         .         .         .       g.40260
 AATATTGTCCGAACTCCATCTGTTGCTCAGATTGGAATTTCAGTGGAATTATTAGACAGT       c.360
 N  I  V  R  T  P  S  V  A  Q  I  G  I  S  V  E  L  L  D  S         p.120

          .         .         .         .         .         .       g.40320
 ATGGCTCAGCAGACTCCTGTAGGTAATGCTGCTGTATCCTCAGTTGACTCATTCACTCAG       c.420
 M  A  Q  Q  T  P  V  G  N  A  A  V  S  S  V  D  S  F  T  Q         p.140

  | 04       .         .         .         .         .         .    g.47452
  | TTCACACAAAAGATGTTGGACAATTTCTACAATTTTGCTTCATCATTTGCTGTCTCTCAG    c.480
  | F  T  Q  K  M  L  D  N  F  Y  N  F  A  S  S  F  A  V  S  Q      p.160

          .         .         .         .         .          | 05    g.48374
 GCCCAGATGACACCAAGCCCATCTGAAATGTTCATTCCGGCAAATGTGGTTCTGAAATG | G    c.540
 A  Q  M  T  P  S  P  S  E  M  F  I  P  A  N  V  V  L  K  W  |      p.180

          .         .         .         .         .                 g.48428
 TATGAAAACTTTCAAAGACGACTAGCACAGAACCCTCTCTTTTGGAAAACATAA             c.594
 Y  E  N  F  Q  R  R  L  A  Q  N  P  L  F  W  K  T  X               p.197

          .         .         .         .         .         .       g.48488
 tttgaataaaataatttttaatggattctgaaatttgtcatgttttgaagataactgact       c.*60

          .         .         .         .         .         .       g.48548
 ccatctaaaagtatgaggtcaaaggatcacgaaacctaagtttaaaaactgcttagagac       c.*120

          .         .         .         .         .         .       g.48608
 tgaagcttaattaaaaatctttattaaaaattaaaaacattgaaaaatgaaaatatgttc       c.*180

          .         .         .         .         .         .       g.48668
 atcattaaagacttttttccccttaagcttaaaataccattcaaaggcaagacattttgt       c.*240

          .         .         .         .         .         .       g.48728
 tttggctatgattcattttttttacttaaaaataaaacctataccaaacagtagtgtgcc       c.*300

                                                                    g.48733
 aagta                                                              c.*305

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Chromosome 11 open reading frame 73 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.