chromosome 12 open reading frame 65 (C12orf65) - coding DNA reference sequence

(used for variant description)

(last modified December 9, 2024)

This file was created to facilitate the description of sequence variants on transcript NM_152269.4 in the C12orf65 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering C12orf65 transcript NM_152269.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5023
                                      ttgctgtgaaactctcttctctg       c.-241

 .         .         .         .         .         .                g.5083
 attggctctctgggagccagccgctgccacgagggaaagaagcttcagtttctcgcatgc       c.-181

 .         .         .         .         .         .                g.5143
 gcagtgagtaaacatgagcctctggtagataagagaaaccgcgatcggagtacggcgcgt       c.-121

 .         .         .         .         .         .                g.5203
 gcgcagatcagggatcgcgattgcgaatcctccgctgaggtgatttggatatccctagaa       c.-61

 .         .         .         .  | 02      .         .             g.25378
 cgttgagggcacgagtcgggtcctgagaccag | gtcctcagccagcagagccacgttcctt    c.-1

          .         .         .         .         .         .       g.25438
 ATGAGCACCGTGGGTTTATTTCATTTTCCTACACCACTGACCCGAATATGCCCGGCGCCA       c.60
 M  S  T  V  G  L  F  H  F  P  T  P  L  T  R  I  C  P  A  P         p.20

          .         .         .         .         .         .       g.25498
 TGGGGACTCCGGCTTTGGGAGAAGCTGACGTTGTTATCCCCAGGAATAGCTGTCACTCCG       c.120
 W  G  L  R  L  W  E  K  L  T  L  L  S  P  G  I  A  V  T  P         p.40

          .         .         .         .         .         .       g.25558
 GTCCAGATGGCAGGCAAGAAGGACTACCCTGCACTGCTTTCCTTGGATGAGAATGAACTC       c.180
 V  Q  M  A  G  K  K  D  Y  P  A  L  L  S  L  D  E  N  E  L         p.60

          .         .         .         .         .         .       g.25618
 GAAGAGCAGTTTGTGAAAGGACACGGTCCAGGGGGCCAGGCAACCAACAAAACCAGCAAC       c.240
 E  E  Q  F  V  K  G  H  G  P  G  G  Q  A  T  N  K  T  S  N         p.80

          .         .         .         .   | 03     .         .    g.28534
 TGCGTGGTGCTGAAGCACATCCCCTCAGGCATCGTTGTAAAG | TGCCATCAGACAAGATCA    c.300
 C  V  V  L  K  H  I  P  S  G  I  V  V  K   | C  H  Q  T  R  S      p.100

          .         .         .         .         .         .       g.28594
 GTTGATCAGAACAGAAAGCTAGCTCGGAAAATCCTACAAGAGAAAGTAGATGTTTTCTAC       c.360
 V  D  Q  N  R  K  L  A  R  K  I  L  Q  E  K  V  D  V  F  Y         p.120

          .         .         .         .         .         .       g.28654
 AATGGTGAAAACAGTCCTGTTCACAAAGAAAAACGAGAAGCGGCGAAGAAAAAACAAGAA       c.420
 N  G  E  N  S  P  V  H  K  E  K  R  E  A  A  K  K  K  Q  E         p.140

          .         .         .         .         .         .       g.28714
 AGGAAAAAAAGAGCAAAGGAAACCCTGGAAAAAAAGAAGCTACTTAAAGAACTGTGGGAG       c.480
 R  K  K  R  A  K  E  T  L  E  K  K  K  L  L  K  E  L  W  E         p.160

          .         .                                               g.28735
 TCAAGTAAAAAGGTCCACTGA                                              c.501
 S  S  K  K  V  H  X                                                p.166

          .         .         .         .         .         .       g.28795
 gaaaagaattagagattccaactgacagaatctgccagaagctcccagggaataatggtg       c.*60

          .         .         .         .         .         .       g.28855
 gcgagttccatcaccagcattattatagtgcttcaaaagaaatatttttgatgaacttaa       c.*120

          .         .         .         .         .         .       g.28915
 aagacaacaaatttatttaaatggtgcactaaactgtagtgaacagagacatgcacgatt       c.*180

          .         .         .         .         .         .       g.28975
 caagaataaaactcggctgggcacggtggacggtgcctcacatctgtaatcccagcactt       c.*240

          .         .         .         .         .         .       g.29035
 tgggaggccgaggcgggcggatcacttgaggtcaggagtttgagaccagcctggccaaca       c.*300

          .         .         .         .         .         .       g.29095
 tggtgaaaccccgtctctactaaaaatacaaaaaattagccaggcatggtggcgggcacc       c.*360

          .         .         .         .         .         .       g.29155
 tgtaatcccagctactcgggaggccgaggcaggagaattgcgtgaacctgggaggcggag       c.*420

          .         .         .         .         .         .       g.29215
 gttgcagtgagctgagatcgcgccactgcactcaagcctgggcaacacctgggtgacaga       c.*480

          .         .         .         .         .         .       g.29275
 gcgagaccccatctcaaaaaaaaaataaaactagttcaagtgcaatgacacacgcctata       c.*540

          .         .         .         .         .         .       g.29335
 atcccagcaccttgggaggctaagacaggaagatcacctgagcccaggagctcaagattg       c.*600

          .         .         .         .         .         .       g.29395
 cagtgagctatgaacaccactgcactccacctgtccacttgttcttgtgtgacagaacaa       c.*660

          .         .         .         .         .         .       g.29455
 gaccctgtctctaaaaaataagataaaaccataaagaaacacagtcagtactatacaaga       c.*720

          .         .         .         .         .         .       g.29515
 ataatggctacttctagagggaaggagttgtcattgtgatgaggcacttggaggggttct       c.*780

          .         .         .         .         .         .       g.29575
 ggggtgcctgacaaagttctgtttcttcacctgggtggtagttagaagggtgtccccgta       c.*840

          .         .         .         .         .         .       g.29635
 tttcaaattgtacctttgtgagattgtatgttttgtaataataaaattttttttgtaatt       c.*900

          .         .                                               g.29663
 agtaaagtcaatttttatggagaactgg                                       c.*928

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Chromosome 12 open reading frame 65 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.