chromosome 17 open reading frame 62 (C17orf62) - coding DNA reference sequence

(used for variant description)

(last modified August 12, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_001033046.3 in the C17orf62 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering C17orf62 transcript NM_001033046.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5050
           ccaatcccggaagcgcgcgcggccccgcccccgaaagtcggctcggctcc       c.-121

 .         .         .         .         .         .                g.5110
 gctccaatcccggaagtgcgcgcggccccgcccccgccggttcgcgtctctctgctgcgg       c.-61

 .         .         .  | 02      .         .         .             g.6577
 cgcggggaccgctgtgctctcg | acccctcctcctgtagagagtggtgctgccctctcggg    c.-1

          .         .         .         .         .         .       g.6637
 ATGTACCTGCAGGTGGAGACCCGCACCAGCTCCCGCCTCCATCTGAAGAGGGCTCCAGGC       c.60
 M  Y  L  Q  V  E  T  R  T  S  S  R  L  H  L  K  R  A  P  G         p.20

          .         .      | 03  .         .         .         .    g.8245
 ATCCGGTCCTGGTCCCTGCTGGTTG | GAATCTTGTCGATTGGCCTGGCTGCTGCCTACTAC    c.120
 I  R  S  W  S  L  L  V  G |   I  L  S  I  G  L  A  A  A  Y  Y      p.40

         | 04.         .         .         .         .         .    g.9188
 AGCGGAG | ATAGCCTGGGCTGGAAGCTCTTCTACGTCACAGGCTGCCTGTTTGTGGCTGTG    c.180
 S  G  D |   S  L  G  W  K  L  F  Y  V  T  G  C  L  F  V  A  V      p.60

          .         .  | 05      .         .         .         .    g.9910
 CAGAACTTGGAGGACTGGGAG | GAAGCCATCTTCGACAAGAGCACAGGGAAGGTTGTTTTG    c.240
 Q  N  L  E  D  W  E   | E  A  I  F  D  K  S  T  G  K  V  V  L      p.80

          .         .         .         .         .         | 06    g.11242
 AAGACGTTCAGCCTCTACAAGAAGCTGCTGACTCTTTTCAGAGCTGGCCACGACCAGG | TG    c.300
 K  T  F  S  L  Y  K  K  L  L  T  L  F  R  A  G  H  D  Q  V |       p.100

          .         .         .         .         .         .       g.11302
 GTGGTCCTGCTCCATGATGTCCGTGATGTGAGCGTGGAGGAGGAGAAGGTCCGGTACTTC       c.360
 V  V  L  L  H  D  V  R  D  V  S  V  E  E  E  K  V  R  Y  F         p.120

          .         .         .         .         .         .       g.11362
 GGGAAAGGCTACATGGTGGTGCTCCGGCTTGCGACGGGCTTCTCCCACCCCCTCACGCAG       c.420
 G  K  G  Y  M  V  V  L  R  L  A  T  G  F  S  H  P  L  T  Q         p.140

          .         .    | 07    .         .         .         .    g.11744
 AGTGCAGTCATGGGCCACCGCAG | TGATGTGGAAGCCATCGCCAAGCTCATCACCAGCTTC    c.480
 S  A  V  M  G  H  R  S  |  D  V  E  A  I  A  K  L  I  T  S  F      p.160

          .         .         .         .         .         .       g.11804
 CTGGAGCTGCACTGCCTTGAGAGCCCCACAGAGCTGTCTCAGAGCAGCGACAGTGAGGCC       c.540
 L  E  L  H  C  L  E  S  P  T  E  L  S  Q  S  S  D  S  E  A         p.180

          .         .                                               g.11828
 GGTGACCCTGCAAGCCAGAGCTGA                                           c.564
 G  D  P  A  S  Q  S  X                                             p.187

          .         .         .         .         .         .       g.11888
 cagccccactgtgcctgagcccgtgcaccgcccacaggacccatggcacattcccggtgt       c.*60

          .         .         .         .         .         .       g.11948
 gcctgagcccgtgcaccgcccacaggacccgtggcacattcccggtgtgcctgagcccgt       c.*120

          .         .         .         .         .         .       g.12008
 gcaccgcccacaggacccgtggcacattcccggtgtgcctgagcccgtgcaccgcccaca       c.*180

          .         .         .         .         .         .       g.12068
 ggacccgtggcacattcccggtgtgcctgagcccgtgcaccgcccacaggacccgtggcc       c.*240

          .         .         .         .         .         .       g.12128
 ttggcttcagttggtgcctccagccgagttggcctattgcctgctcatgctgctgcttgc       c.*300

          .         .         .         .         .         .       g.12188
 acactgcatgaaacagcaggccagaccaggacatccagactttctccatcgtgaggcctg       c.*360

          .         .         .         .         .         .       g.12248
 ggcctgcctttctgcagccggaggtctcgccagccctggactcctgctttgggccacagc       c.*420

          .         .         .         .         .         .       g.12308
 aagacctcgggcgagtggagaggcggggccaggccgggcccttgtgggtgctgatgctgc       c.*480

          .         .         .         .         .         .       g.12368
 atgttgtccccgacacagcgtcctctccctggtggacatccccagcggtcaggtgcttcc       c.*540

          .         .         .         .         .         .       g.12428
 ccaagggcagtgaggggtgaacatccagggcctacctggctgtgcacgctgcagccacac       c.*600

          .         .         .         .         .         .       g.12488
 tgtggaagctgcccctccccgaggacccgcctcccttgctgatgccaggatctcggcgca       c.*660

          .         .         .         .         .         .       g.12548
 tagaccactctgccccagcggtcgtcacagaaaggtctctctgttcctcacactcagctt       c.*720

          .         .         .         .         .         .       g.12608
 cagcataagctgtgaggccagaaaaaaggtcagctcttctagtatcgtgcagtgcttaaa       c.*780

          .         .         .         .         .         .       g.12668
 aaccgggagctccagccgggcgcagtggttcatgccagtaatcccagcactttcggaggc       c.*840

          .         .         .         .         .         .       g.12728
 cgaggtgggaggattgcttgaggccaggagttcaagaccagcctgggcaacacagcaaga       c.*900

          .         .         .         .         .         .       g.12788
 tcctgtctttgtaaaaaaactaaccaaacaggaaaaactgggagattttctgcagaaatt       c.*960

          .         .         .         .         .         .       g.12848
 gagttccagcctctctcgaacctgggaagacctggcaggagggggctgggctctcggcta       c.*1020

          .         .         .         .         .         .       g.12908
 cagacttctccccaccccgtaggagctgaacgccaaccatcctgacccgccagtgctctt       c.*1080

          .         .         .         .         .         .       g.12968
 ggtctcctgagtgtacccaggtcctcccaggtgcggtgtgcaccgagcgcgcctggcctg       c.*1140

          .         .         .         .         .         .       g.13028
 atgccctggcctgtgagctggggactcctgggccctgtgagcccctaggcggcaggccca       c.*1200

          .         .         .         .         .         .       g.13088
 ggaatggctgggtaggacagggaacacctttgccccacgtctggctgtgacctcggtgaa       c.*1260

          .         .         .         .         .         .       g.13148
 agccgacaggagagagatgggaccctcctcctcagtagtggctgccagtccctcgttgca       c.*1320

          .         .         .         .         .         .       g.13208
 ggacagggtcatcataaccataaataacccttcacgtgtcacctgcagcttccactcttt       c.*1380

          .         .         .                                     g.13246
 atttccaaagaatcagtgtcacacatgcagatcacaaa                             c.*1418

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Chromosome 17 open reading frame 62 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.