calcium channel, voltage-dependent, L type, alpha 1F subunit (CACNA1F) - coding DNA reference sequence

(used for variant description)

(last modified February 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_005183.2 in the CACNA1F gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009095.1, covering CACNA1F transcript NM_005183.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5002
                                                           ct       c.-61

 .         .         .         .         .         .                g.5062
 ccaaagctgggggaagagaggggggttgtgtgcagatggcccttcaatctcgaaagaaag       c.-1

          .         .      | 02  .         .         .         .    g.6479
 ATGTCGGAATCTGAAGGCGGGAAAG | ACACCACCCCAGAGCCCAGTCCAGCCAATGGGGCA    c.60
 M  S  E  S  E  G  G  K  D |   T  T  P  E  P  S  P  A  N  G  A      p.20

          .         .         .         .         .         .       g.6539
 GGCCCTGGTCCCGAATGGGGGCTGTGCCCCGGGCCCCCAGCTGTGGAAGGTGAAAGCAGT       c.120
 G  P  G  P  E  W  G  L  C  P  G  P  P  A  V  E  G  E  S  S         p.40

          .         .         .         .         .         .       g.6599
 GGGGCATCAGGCCTAGGGACCCCTAAGCGAAGAAACCAGCACAGCAAGCACAAGACAGTG       c.180
 G  A  S  G  L  G  T  P  K  R  R  N  Q  H  S  K  H  K  T  V         p.60

          .         .         .         .         .         .       g.6659
 GCAGTGGCCAGTGCCCAGCGGTCACCTCGGGCACTCTTCTGCCTCACCCTGGCCAATCCT       c.240
 A  V  A  S  A  Q  R  S  P  R  A  L  F  C  L  T  L  A  N  P         p.80

          .         .         .      | 03  .         .         .    g.7089
 CTGCGACGGTCCTGCATCAGCATCGTGGAGTGGAA | GCCCTTCGACATCCTCATCCTGCTG    c.300
 L  R  R  S  C  I  S  I  V  E  W  K  |  P  F  D  I  L  I  L  L      p.100

          .         .         .         .         .         .       g.7149
 ACCATCTTTGCCAACTGCGTGGCCCTGGGAGTTTACATCCCCTTCCCTGAGGACGACTCC       c.360
 T  I  F  A  N  C  V  A  L  G  V  Y  I  P  F  P  E  D  D  S         p.120

          .         .  | 04      .         .         .         .    g.7421
 AACACTGCCAACCACAACCTG | GAGCAGGTGGAGTACGTATTCCTGGTGATTTTCACTGTG    c.420
 N  T  A  N  H  N  L   | E  Q  V  E  Y  V  F  L  V  I  F  T  V      p.140

          .         .         .         .         .         .       g.7481
 GAGACGGTGCTCAAGATCGTGGCCTACGGGCTGGTGCTCCACCCCAGCGCCTACATCCGC       c.480
 E  T  V  L  K  I  V  A  Y  G  L  V  L  H  P  S  A  Y  I  R         p.160

          .         .         .         .  | 05      .         .    g.7781
 AATGGCTGGAACCTACTCGACTTCATCATCGTCGTGGTCGG | GCTGTTCAGCGTTCTGCTG    c.540
 N  G  W  N  L  L  D  F  I  I  V  V  V  G  |  L  F  S  V  L  L      p.180

          .         .         .         .         .         .       g.7841
 GAGCAGGGCCCCGGACGGCCAGGCGACGCCCCGCACACCGGGGGAAAGCCAGGAGGCTTC       c.600
 E  Q  G  P  G  R  P  G  D  A  P  H  T  G  G  K  P  G  G  F         p.200

          .         .         .         .         .         .       g.7901
 GATGTGAAGGCATTGAGGGCGTTTCGGGTGCTGCGGCCACTGAGGCTGGTGTCTGGGGTC       c.660
 D  V  K  A  L  R  A  F  R  V  L  R  P  L  R  L  V  S  G  V         p.220

      | 06   .         .         .         .         .         .    g.8055
 CCGA | GCCTGCACATAGTGCTCAATTCCATCATGAAGGCTCTGGTGCCGCTGCTGCACATT    c.720
 P  S |   L  H  I  V  L  N  S  I  M  K  A  L  V  P  L  L  H  I      p.240

          .         .         .         .         .         .       g.8115
 GCACTGCTCGTGCTCTTCGTCATCATCATTTATGCCATCATTGGGCTCGAGCTGTTCCTT       c.780
 A  L  L  V  L  F  V  I  I  I  Y  A  I  I  G  L  E  L  F  L         p.260

          .         .         .        | 07.         .         .    g.9947
 GGACGAATGCACAAGACGTGCTACTTCCTGGGATCCG | ACATGGAAGCGGAGGAGGACCCA    c.840
 G  R  M  H  K  T  C  Y  F  L  G  S  D |   M  E  A  E  E  D  P      p.280

          .         .         .         .         .         .       g.10007
 TCGCCCTGTGCGTCTTCGGGATCAGGGCGTGCGTGCACGCTGAACCAGACTGAGTGCCGC       c.900
 S  P  C  A  S  S  G  S  G  R  A  C  T  L  N  Q  T  E  C  R         p.300

          .         .         .         .         .         .       g.10067
 GGGCGCTGGCCAGGGCCCAATGGAGGCATCACCAACTTTGACAACTTCTTCTTCGCCATG       c.960
 G  R  W  P  G  P  N  G  G  I  T  N  F  D  N  F  F  F  A  M         p.320

          .         .         .         .         .     | 08   .    g.10238
 CTGACAGTCTTCCAGTGTGTCACCATGGAAGGCTGGACCGATGTGCTCTACTGG | ATGCAA    c.1020
 L  T  V  F  Q  C  V  T  M  E  G  W  T  D  V  L  Y  W   | M  Q      p.340

          .         .         .         .         .         .       g.10298
 GATGCCATGGGGTATGAACTGCCCTGGGTGTACTTTGTGAGCCTTGTCATCTTTGGGTCC       c.1080
 D  A  M  G  Y  E  L  P  W  V  Y  F  V  S  L  V  I  F  G  S         p.360

          .         .         .         | 09         .         .    g.11266
 TTCTTCGTCCTCAACCTTGTGCTTGGCGTCCTGAGTGG | GGAGTTCTCCAAGGAGAGAGAG    c.1140
 F  F  V  L  N  L  V  L  G  V  L  S  G  |  E  F  S  K  E  R  E      p.380

          .         .         .         .         .         .       g.11326
 AAAGCGAAAGCTCGCGGGGACTTCCAGAAGCAGCGGGAGAAGCAGCAGATGGAGGAAGAC       c.1200
 K  A  K  A  R  G  D  F  Q  K  Q  R  E  K  Q  Q  M  E  E  D         p.400

          .         .         .         .         .         .       g.11386
 CTGCGGGGCTACCTGGACTGGATCACTCAAGCCGAAGAGCTGGACATGGAGGACCCCTCC       c.1260
 L  R  G  Y  L  D  W  I  T  Q  A  E  E  L  D  M  E  D  P  S         p.420

          .         .         .         .          | 10        .    g.11680
 GCCGATGACAACCTTGGTTCTATGGCTGAAGAGGGCCGGGCGGGCCATC | GGCCACAGCTG    c.1320
 A  D  D  N  L  G  S  M  A  E  E  G  R  A  G  H  R |   P  Q  L      p.440

          .         .         .         .         .         .       g.11740
 GCCGAGCTGACCAATAGGAGGCGTGGACGTCTGCGCTGGTTCAGTCATTCTACTCGCTCC       c.1380
 A  E  L  T  N  R  R  R  G  R  L  R  W  F  S  H  S  T  R  S         p.460

          .         .   | 11     .         .         .         .    g.11907
 ACACACTCCACCAGCAGCCATG | CCAGCCTCCCAGCCAGTGACACCGGTTCCATGACAGAG    c.1440
 T  H  S  T  S  S  H  A |   S  L  P  A  S  D  T  G  S  M  T  E      p.480

          .         .         .         .         .       | 12 .    g.12132
 ACCCAAGGCGATGAGGATGAGGAGGAGGGGGCTCTGGCCAGCTGTACACGCTGCCT | AAAC    c.1500
 T  Q  G  D  E  D  E  E  E  G  A  L  A  S  C  T  R  C  L  |  N      p.500

          .         .    | 13    .         .         .         .    g.12339
 AAGATCATGAAAACCAGAGTCTG | CCGCCGCCTCCGCCGAGCCAACCGGGTCCTTCGGGCA    c.1560
 K  I  M  K  T  R  V  C  |  R  R  L  R  R  A  N  R  V  L  R  A      p.520

          .         .         .         .         .         .       g.12399
 CGCTGCCGTCGGGCAGTGAAGTCCAATGCCTGCTACTGGGCTGTGCTGTTGCTCGTCTTC       c.1620
 R  C  R  R  A  V  K  S  N  A  C  Y  W  A  V  L  L  L  V  F         p.540

          .         .         .         .         .         .       g.12459
 CTCAACACGTTGACCATCGCCTCTGAGCACCACGGGCAGCCTGTGTGGCTCACCCAGATC       c.1680
 L  N  T  L  T  I  A  S  E  H  H  G  Q  P  V  W  L  T  Q  I         p.560

      | 14   .         .         .         .         .         .    g.13441
 CAGG | AGTATGCCAACAAAGTGTTGCTCTGTCTGTTCACGGTGGAGATGCTTCTCAAATTG    c.1740
 Q  E |   Y  A  N  K  V  L  L  C  L  F  T  V  E  M  L  L  K  L      p.580

          .         .         .         .         .         .       g.13501
 TACGGTCTGGGCCCCTCTGCCTATGTGTCTTCCTTCTTCAACCGCTTTGACTGCTTTGTG       c.1800
 Y  G  L  G  P  S  A  Y  V  S  S  F  F  N  R  F  D  C  F  V         p.600

          .         .         .         .         .         .       g.13561
 GTCTGTGGGGGCATCCTAGAGACCACCTTGGTGGAGGTGGGCGCCATGCAGCCCTTGGGC       c.1860
 V  C  G  G  I  L  E  T  T  L  V  E  V  G  A  M  Q  P  L  G         p.620

          .         .         .         .         . | 15       .    g.15248
 ATCTCAGTGCTCCGATGTGTGCGCCTCCTCAGGATCTTTAAGGTCACCAG | ACACTGGGCT    c.1920
 I  S  V  L  R  C  V  R  L  L  R  I  F  K  V  T  R  |  H  W  A      p.640

          .         .         .         .         .         .       g.15308
 TCTCTGAGCAATCTGGTGGCATCCCTGCTCAATTCAATGAAATCCATCGCATCCTTGCTG       c.1980
 S  L  S  N  L  V  A  S  L  L  N  S  M  K  S  I  A  S  L  L         p.660

          .         .         .         .         .         .       g.15368
 CTTCTCCTCTTCCTCTTCATCATTATCTTCTCCCTGCTTGGCATGCAGCTGTTTGGGGGC       c.2040
 L  L  L  F  L  F  I  I  I  F  S  L  L  G  M  Q  L  F  G  G         p.680

          .         .         .         .         .         .       g.15428
 AAGTTCAACTTTGACCAGACCCACACCAAGCGAAGCACCTTTGACACGTTCCCCCAGGCC       c.2100
 K  F  N  F  D  Q  T  H  T  K  R  S  T  F  D  T  F  P  Q  A         p.700

          .         | 16         .         .         .         .    g.15578
 CTCCTCACTGTCTTTCAG | ATCCTGACAGGTGAGGACTGGAACGTGGTCATGTATGATGGT    c.2160
 L  L  T  V  F  Q   | I  L  T  G  E  D  W  N  V  V  M  Y  D  G      p.720

          .         .         .         .         .         .       g.15638
 ATCATGGCATATGGTGGCCCCTTCTTCCCAGGAATGTTGGTGTGCATCTATTTCATCATT       c.2220
 I  M  A  Y  G  G  P  F  F  P  G  M  L  V  C  I  Y  F  I  I         p.740

          .          | 17        .         .         .         .    g.15812
 CTCTTCATCTGTGGCAACT | ACATCCTGTTGAACGTGTTTCTTGCCATTGCTGTGGACAAC    c.2280
 L  F  I  C  G  N  Y |   I  L  L  N  V  F  L  A  I  A  V  D  N      p.760

          .         .         .         .  | 18      .         .    g.17313
 CTGGCCAGTGGAGATGCAGGCACTGCCAAGGACAAGGGCGG | GGAGAAGAGCAATGAGAAG    c.2340
 L  A  S  G  D  A  G  T  A  K  D  K  G  G  |  E  K  S  N  E  K      p.780

          .         .        | 19.         .         .         .    g.17883
 GATCTCCCACAGGAGAATGAAGGCCTG | GTGCCTGGTGTGGAGAAAGAGGAAGAGGAGGGT    c.2400
 D  L  P  Q  E  N  E  G  L   | V  P  G  V  E  K  E  E  E  E  G      p.800

          .          | 20        .         .         .         .    g.18625
 GCAAGGAGGGAAGGAGCAG | ACATGGAGGAGGAGGAGGAGGAGGAAGAAGAGGAAGAAGAG    c.2460
 A  R  R  E  G  A  D |   M  E  E  E  E  E  E  E  E  E  E  E  E      p.820

          .         .         .         .         .         .       g.18685
 GAAGAAGAGGAAGAGGGTGCAGGGGGTGTGGAACTCCTGCAGGAAGTTGTACCCAAGGAG       c.2520
 E  E  E  E  E  G  A  G  G  V  E  L  L  Q  E  V  V  P  K  E         p.840

          .         .         .         .         .       | 21 .    g.18928
 AAGGTGGTACCCATCCCTGAGGGCAGCGCCTTCTTCTGCCTCAGCCAAACCAACCC | GCTG    c.2580
 K  V  V  P  I  P  E  G  S  A  F  F  C  L  S  Q  T  N  P  |  L      p.860

          .         .         .         .         .         .       g.18988
 AGGAAGGGCTGCCACACCCTCATCCACCATCATGTCTTCACCAATCTTATCCTGGTGTTC       c.2640
 R  K  G  C  H  T  L  I  H  H  H  V  F  T  N  L  I  L  V  F         p.880

          .         .         .         .         .         .       g.19048
 ATCATCCTCAGCAGTGTGTCCCTGGCCGCTGAGGACCCCATCCGAGCCCACTCCTTCCGC       c.2700
 I  I  L  S  S  V  S  L  A  A  E  D  P  I  R  A  H  S  F  R         p.900

        | 22 .         .         .         .         .         .    g.19487
 AACCAT | ATTCTGGGTTACTTCGATTATGCCTTCACCTCCATTTTCACTGTGGAGATTCTA    c.2760
 N  H   | I  L  G  Y  F  D  Y  A  F  T  S  I  F  T  V  E  I  L      p.920

        | 23 .         .         .         .         .         .    g.19693
 CTAAAG | ATGACAGTGTTTGGGGCCTTCCTGCACCGCGGCTCCTTCTGCCGTAGCTGGTTT    c.2820
 L  K   | M  T  V  F  G  A  F  L  H  R  G  S  F  C  R  S  W  F      p.940

          .         .         .         .         .    | 24    .    g.19839
 AATATGTTGGATCTGCTGGTGGTCAGTGTGTCCCTCATCTCCTTTGGCATCCA | CTCCAGC    c.2880
 N  M  L  D  L  L  V  V  S  V  S  L  I  S  F  G  I  H  |  S  S      p.960

          .         .         .         .         .         .       g.19899
 GCCATCTCGGTGGTGAAGATTCTGCGAGTACTCCGAGTACTGCGGCCCCTCCGAGCCATC       c.2940
 A  I  S  V  V  K  I  L  R  V  L  R  V  L  R  P  L  R  A  I         p.980

          .         .  | 25      .         .         .         .    g.20408
 AACAGGGCCAAGGGACTCAAG | CATGTGGTGCAGTGTGTATTTGTGGCCATCCGGACCATC    c.3000
 N  R  A  K  G  L  K   | H  V  V  Q  C  V  F  V  A  I  R  T  I      p.1000

          .         .         .         .         .         .       g.20468
 GGAAACATCATGATTGTCACCACACTTCTGCAATTTATGTTCGCCTGCATCGGGGTGCAG       c.3060
 G  N  I  M  I  V  T  T  L  L  Q  F  M  F  A  C  I  G  V  Q         p.1020

           | 26        .         .         .         .         .    g.20618
 CTCTTCAAG | GGGAAATTCTACACCTGCACGGACGAGGCCAAACACACCCCTCAAGAATGC    c.3120
 L  F  K   | G  K  F  Y  T  C  T  D  E  A  K  H  T  P  Q  E  C      p.1040

    | 27     .         .         .         .         .         .    g.21903
 AA | GGGCTCCTTCCTGGTATACCCAGATGGAGACGTGTCACGGCCCCTGGTCCGGGAGCGG    c.3180
 K  |  G  S  F  L  V  Y  P  D  G  D  V  S  R  P  L  V  R  E  R      p.1060

          .         .         .         .         .         .       g.21963
 CTCTGGGTCAACAGTGATTTCAACTTTGACAATGTCCTTTCAGCCATGATGGCCCTGTTC       c.3240
 L  W  V  N  S  D  F  N  F  D  N  V  L  S  A  M  M  A  L  F         p.1080

          .         .          | 28        .         .         .    g.22861
 ACTGTCTCCACCTTTGAAGGCTGGCCTGC | ACTGCTATACAAGGCCATCGATGCATATGCA    c.3300
 T  V  S  T  F  E  G  W  P  A  |  L  L  Y  K  A  I  D  A  Y  A      p.1100

          .         .         .         .         .         .       g.22921
 GAGGACCATGGCCCCATCTATAATTACCGTGTGGAGATCTCAGTGTTCTTCATTGTCTAC       c.3360
 E  D  H  G  P  I  Y  N  Y  R  V  E  I  S  V  F  F  I  V  Y         p.1120

          .         .         .         .         .         .       g.22981
 ATCATCATCATTGCGTTCTTCATGATGAACATCTTCGTGGGCTTCGTCATCATCACTTTC       c.3420
 I  I  I  I  A  F  F  M  M  N  I  F  V  G  F  V  I  I  T  F         p.1140

          .         .         .         .         .  | 29      .    g.23138
 CGTGCCCAGGGCGAGCAGGAGTACCAAAACTGTGAGCTGGACAAGAACCAG | CGTCAATGT    c.3480
 R  A  Q  G  E  Q  E  Y  Q  N  C  E  L  D  K  N  Q   | R  Q  C      p.1160

          .         .         .         .         .         .       g.23198
 GTGGAATATGCCCTCAAGGCCCAGCCACTCCGCCGTTACATCCCCAAGAACCCGCATCAG       c.3540
 V  E  Y  A  L  K  A  Q  P  L  R  R  Y  I  P  K  N  P  H  Q         p.1180

          .         .         .         .         .         .       g.23258
 TATCGTGTGTGGGCCACTGTGAACTCTGCTGCCTTTGAGTACCTGATGTTCCTGCTCATC       c.3600
 Y  R  V  W  A  T  V  N  S  A  A  F  E  Y  L  M  F  L  L  I         p.1200

          .         .         . | 30       .         .         .    g.24134
 CTGCTCAACACAGTTGCCCTAGCCATGCAG | CACTATGAGCAGACTGCTCCCTTCAACTAT    c.3660
 L  L  N  T  V  A  L  A  M  Q   | H  Y  E  Q  T  A  P  F  N  Y      p.1220

          .         .         .         .         .         .       g.24194
 GCCATGGACATCCTCAACATGGTCTTCACTGGCCTCTTCACTATTGAGATGGTGCTCAAA       c.3720
 A  M  D  I  L  N  M  V  F  T  G  L  F  T  I  E  M  V  L  K         p.1240

          .         .  | 31      .         .         .         .    g.24510
 ATCATCGCCTTCAAGCCCAAG | CATTACTTCACTGATGCCTGGAACACGTTTGACGCTCTT    c.3780
 I  I  A  F  K  P  K   | H  Y  F  T  D  A  W  N  T  F  D  A  L      p.1260

          .         .         .         .      | 32  .         .    g.25394
 ATTGTGGTGGGCAGCATAGTGGATATTGCCGTCACTGAAGTCAAT | AATGGTGGCCACCTT    c.3840
 I  V  V  G  S  I  V  D  I  A  V  T  E  V  N   | N  G  G  H  L      p.1280

        | 33 .         .         .         .         .         .    g.25632
 GGCGAG | AGCTCTGAGGACAGCTCCCGCATTTCCATTACCTTCTTTCGCCTCTTCCGAGTT    c.3900
 G  E   | S  S  E  D  S  S  R  I  S  I  T  F  F  R  L  F  R  V      p.1300

          .         .         .         .         .         .       g.25692
 ATGCGGCTGGTCAAGCTTCTCAGTAAGGGTGAAGGGATCCGCACATTGCTCTGGACATTC       c.3960
 M  R  L  V  K  L  L  S  K  G  E  G  I  R  T  L  L  W  T  F         p.1320

          .      | 34  .         .         .         .         .    g.26110
 ATCAAGTCCTTCCAG | GCCTTGCCCTATGTGGCTCTTCTCATCGCAATGATATTCTTCATC    c.4020
 I  K  S  F  Q   | A  L  P  Y  V  A  L  L  I  A  M  I  F  F  I      p.1340

          .         .  | 35      .         .         .         .    g.26423
 TATGCCGTCATTGGCATGCAG | ATGTTCGGCAAGGTGGCTCTTCAGGATGGCACACAGATA    c.4080
 Y  A  V  I  G  M  Q   | M  F  G  K  V  A  L  Q  D  G  T  Q  I      p.1360

          .         .         .         .         .    | 36    .    g.26899
 AACCGAAACAACAACTTCCAGACCTTTCCACAGGCTGTGCTGCTTCTGTTCAG | GTGTGCC    c.4140
 N  R  N  N  N  F  Q  T  F  P  Q  A  V  L  L  L  F  R  |  C  A      p.1380

          .         .         .         .         .         .       g.26959
 ACTGGTGAGGCATGGCAGGAGATAATGCTTGCCAGCCTTCCCGGAAATCGGTGTGATCCT       c.4200
 T  G  E  A  W  Q  E  I  M  L  A  S  L  P  G  N  R  C  D  P         p.1400

          .         .         .         .         .         .       g.27019
 GAGTCTGACTTCGGCCCTGGTGAAGAGTTTACCTGTGGTAGCAATTTTGCCATCGCCTAT       c.4260
 E  S  D  F  G  P  G  E  E  F  T  C  G  S  N  F  A  I  A  Y         p.1420

          .         .         .    | 37    .         .         .    g.27308
 TTCATCAGCTTCTTCATGCTCTGTGCCTTCCTG | ATCATAAATCTCTTTGTGGCTGTGATC    c.4320
 F  I  S  F  F  M  L  C  A  F  L   | I  I  N  L  F  V  A  V  I      p.1440

          .         .         .         .         .         .       g.27368
 ATGGACAACTTTGATTATCTCACCAGAGATTGGTCCATCCTGGGCCCCCATCACCTTGAT       c.4380
 M  D  N  F  D  Y  L  T  R  D  W  S  I  L  G  P  H  H  L  D         p.1460

          .         .         .         .  | 38      .         .    g.27706
 GAATTCAAGAGGATCTGGTCTGAATATGACCCTGGGGCCAA | GGGCCGCATCAAACACTTG    c.4440
 E  F  K  R  I  W  S  E  Y  D  P  G  A  K  |  G  R  I  K  H  L      p.1480

          .         .         .         .         .         .       g.27766
 GATGTGGTTGCCCTGCTGAGACGTATCCAGCCCCCTCTGGGATTTGGGAAGCTGTGCCCA       c.4500
 D  V  V  A  L  L  R  R  I  Q  P  P  L  G  F  G  K  L  C  P         p.1500

          .         | 39         .         .         .         .    g.28012
 CACCGAGTGGCCTGCAAG | AGACTTGTGGCAATGAACATGCCCCTCAACTCAGATGGGACG    c.4560
 H  R  V  A  C  K   | R  L  V  A  M  N  M  P  L  N  S  D  G  T      p.1520

          .         .         .         .         .         .       g.28072
 GTGACATTCAACGCCACACTCTTTGCCCTGGTCCGGACATCCCTGAAGATCAAAACAGAA       c.4620
 V  T  F  N  A  T  L  F  A  L  V  R  T  S  L  K  I  K  T  E         p.1540

   | 40      .         .         .         .         .         .    g.28390
 G | GGAACCTGGAGCAAGCCAACCAGGAGCTGCGGATTGTCATCAAAAAGATCTGGAAGCGG    c.4680
 G |   N  L  E  Q  A  N  Q  E  L  R  I  V  I  K  K  I  W  K  R      p.1560

          .         .         .         .    | 41    .         .    g.28631
 ATGAAACAGAAGCTGCTAGATGAGGTCATCCCCCCACCAGACG | AGGAGGAGGTCACCGTG    c.4740
 M  K  Q  K  L  L  D  E  V  I  P  P  P  D  E |   E  E  V  T  V      p.1580

          .         .         .         .         .         .       g.28691
 GGCAAATTCTACGCCACATTTCTGATCCAGGACTATTTCCGCAAATTCCGGCGGAGGAAA       c.4800
 G  K  F  Y  A  T  F  L  I  Q  D  Y  F  R  K  F  R  R  R  K         p.1600

          .         .         .         .         .     | 42   .    g.28986
 GAAAAAGGGCTACTAGGCAACGACGCCGCCCCTAGCACCTCTTCCGCCCTTCAG | GCTGGT    c.4860
 E  K  G  L  L  G  N  D  A  A  P  S  T  S  S  A  L  Q   | A  G      p.1620

          .         .         .         .         .         .       g.29046
 CTGCGGAGCCTGCAGGACTTGGGTCCTGAGATGCGGCAGGCCCTCACCTGTGACACAGAG       c.4920
 L  R  S  L  Q  D  L  G  P  E  M  R  Q  A  L  T  C  D  T  E         p.1640

          .         .         .         .         .         .       g.29106
 GAGGAGGAAGAAGAGGGGCAGGAGGGAGTGGAGGAGGAAGATGAAAAGGACTTGGAAACT       c.4980
 E  E  E  E  E  G  Q  E  G  V  E  E  E  D  E  K  D  L  E  T         p.1660

        | 43 .         .         .         .         .         .    g.29743
 AACAAA | GCCACGATGGTCTCCCAGCCCTCAGCTCGCCGGGGCTCCGGGATTTCTGTGTCT    c.5040
 N  K   | A  T  M  V  S  Q  P  S  A  R  R  G  S  G  I  S  V  S      p.1680

          .         .         .         .         .         .       g.29803
 CTGCCTGTCGGGGACAGACTTCCAGATTCACTCTCCTTTGGGCCCAGTGATGATGACAGG       c.5100
 L  P  V  G  D  R  L  P  D  S  L  S  F  G  P  S  D  D  D  R         p.1700

          .         .         .         .         .       | 44 .    g.31264
 GGGACTCCCACCTCCAGTCAGCCCAGTGTGCCCCAGGCTGGATCCAACACCCACAG | GAGA    c.5160
 G  T  P  T  S  S  Q  P  S  V  P  Q  A  G  S  N  T  H  R  |  R      p.1720

          .         .         .         .         .         .       g.31324
 GGCTCTGGGGCTCTCATTTTCACCATCCCAGAAGAAGGAAATTCTCAGCCCAAGGGAACC       c.5220
 G  S  G  A  L  I  F  T  I  P  E  E  G  N  S  Q  P  K  G  T         p.1740

          .         .         .         .     | 45   .         .    g.31533
 AAAGGGCAAAACAAGCAAGATGAGGATGAGGAAGTCCCTGATCG | GCTTTCCTACCTAGAT    c.5280
 K  G  Q  N  K  Q  D  E  D  E  E  V  P  D  R  |  L  S  Y  L  D      p.1760

          .         .         .         .         .         .       g.31593
 GAGCAGGCAGGGACTCCCCCGTGCTCAGTCCTTTTGCCACCTCACAGAGCTCAGAGATAC       c.5340
 E  Q  A  G  T  P  P  C  S  V  L  L  P  P  H  R  A  Q  R  Y         p.1780

          .         .         .         .         .   | 46     .    g.31757
 ATGGATGGGCACCTGGTACCACGCCGCCGTCTGCTGCCCCCCACACCTGCAG | GTCGGAAG    c.5400
 M  D  G  H  L  V  P  R  R  R  L  L  P  P  T  P  A  G |   R  K      p.1800

          .         .         .         .         .         .       g.31817
 CCCTCCTTCACCATCCAGTGTCTGCAGCGCCAGGGCAGTTGTGAGGATTTACCCATCCCA       c.5460
 P  S  F  T  I  Q  C  L  Q  R  Q  G  S  C  E  D  L  P  I  P         p.1820

          .         .         .         .      | 47  .         .    g.32575
 GGCACCTATCATCGTGGGCGAAATTCAGGGCCCAATAGGGCTCAG | GGTTCCTGGGCAACA    c.5520
 G  T  Y  H  R  G  R  N  S  G  P  N  R  A  Q   | G  S  W  A  T      p.1840

          .         .         .         .         .         .       g.32635
 CCACCTCAGCGGGGTCGGCTCCTGTATGCCCCGCTGTTGTTGGTGGAAGAGGGCGCAGCG       c.5580
 P  P  Q  R  G  R  L  L  Y  A  P  L  L  L  V  E  E  G  A  A         p.1860

          .         .         .         .         .         .       g.32695
 GGGGAGGGGTACCTCGGCAGATCCAGTGGCCCACTGCGCACCTTCACCTGTCTGCACGTG       c.5640
 G  E  G  Y  L  G  R  S  S  G  P  L  R  T  F  T  C  L  H  V         p.1880

          .         .         .         .         .         .       g.32755
 CCTGGAACCCACTCGGACCCCAGCCATGGGAAGAGGGGCAGTGCCGACAGCTTGGTGGAG       c.5700
 P  G  T  H  S  D  P  S  H  G  K  R  G  S  A  D  S  L  V  E         p.1900

     | 48    .         .         .         .         .         .    g.33063
 GCT | GTGCTTATCTCAGAGGGTCTGGGCCTCTTTGCTCGAGACCCACGTTTCGTGGCCCTG    c.5760
 A   | V  L  I  S  E  G  L  G  L  F  A  R  D  P  R  F  V  A  L      p.1920

          .         .         .         .         .         .       g.33123
 GCCAAGCAGGAGATTGCAGATGCGTGTCGCCTGACGCTGGATGAGATGGACAATGCTGCC       c.5820
 A  K  Q  E  I  A  D  A  C  R  L  T  L  D  E  M  D  N  A  A         p.1940

          .         .         .         .         .         .       g.33183
 AGTGACCTGCTGGCACAGGGAACCAGCTCTCTCTATAGCGACGAGGAGTCCATCCTCTCC       c.5880
 S  D  L  L  A  Q  G  T  S  S  L  Y  S  D  E  E  S  I  L  S         p.1960

          .         .         .         .         .                 g.33237
 CGCTTCGATGAGGAGGACTTGGGAGACGAGATGGCCTGCGTCCACGCCCTCTGA             c.5934
 R  F  D  E  E  D  L  G  D  E  M  A  C  V  H  A  L  X               p.1977

          .         .         .         .         .         .       g.33297
 attcccacccctccccaactgctcaataaacctcctgccctcccctccccagcaggaggc       c.*60

          .                                                         g.33311
 aggcatggaccaca                                                     c.*74

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Calcium channel, voltage-dependent, L type, alpha 1F subunit protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center