calcyon neuron-specific vesicular protein (CALY) - coding DNA reference sequence

(used for variant description)

(last modified May 29, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_015722.3 in the CALY gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering CALY transcript NM_015722.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5038
                       cgaccacagcctcggtctcgcagctgcagcccccgccc       c.-121

 .         .         .         .         .         .                g.5098
 cgcccggccgcgaagcgtctggaaccgcatcctccgcatccacatccgcatcgtcgtcct       c.-61

 .         .         .         .          | 02        .             g.12982
 ccccgaccgcgtcctgcagcagctgccagtggagccgcct | gacaaggactgccatccacc    c.-1

          .         .         .         .         .         .       g.13042
 ATGGTGAAGCTGGGCTGCAGCTTCTCTGGGAAGCCAGGTAAAGACCCTGGGGACCAGGAT       c.60
 M  V  K  L  G  C  S  F  S  G  K  P  G  K  D  P  G  D  Q  D         p.20

          .         .         .         .         .         .       g.13102
 GGGGCTGCCATGGACAGTGTGCCTCTGATCAGCCCCTTGGACATCAGCCAGCTCCAGCCG       c.120
 G  A  A  M  D  S  V  P  L  I  S  P  L  D  I  S  Q  L  Q  P         p.40

          .      | 03  .         .         .         .         .    g.14001
 CCACTCCCTGACCAG | GTGGTCATCAAGACACAGACAGAATACCAGCTGTCCTCCCCAGAC    c.180
 P  L  P  D  Q   | V  V  I  K  T  Q  T  E  Y  Q  L  S  S  P  D      p.60

          .         .         .         .         .         .       g.14061
 CAGCAGAATTTCCCTGACCTGGAGGGCCAGAGGCTGAACTGCAGCCACCCAGAGGAAGGG       c.240
 Q  Q  N  F  P  D  L  E  G  Q  R  L  N  C  S  H  P  E  E  G         p.80

        | 04 .         .         .         .         .         .    g.15034
 CGCAGG | CTGCCCACCGCACGGATGATCGCCTTCGCCATGGCGCTACTGGGCTGCGTGCTG    c.300
 R  R   | L  P  T  A  R  M  I  A  F  A  M  A  L  L  G  C  V  L      p.100

          .         .         .         .         .         .       g.15094
 ATCATGTACAAGGCCATCTGGTACGACCAGTTCACCTGCCCCGACGGCTTCCTGCTGCGG       c.360
 I  M  Y  K  A  I  W  Y  D  Q  F  T  C  P  D  G  F  L  L  R         p.120

  | 05       .         .         .         .         .         .    g.15911
  | CACAAGATCTGCACGCCGCTGACCCTGGAGATGTACTACACGGAGATGGACCCCGAGCGC    c.420
  | H  K  I  C  T  P  L  T  L  E  M  Y  Y  T  E  M  D  P  E  R      p.140

          .         .         .         .         .         .       g.15971
 CACCGCAGCATCCTGGCGGCCATCGGGGCCTACCCGCTGAGCCGCAAGCACGGCACGGAG       c.480
 H  R  S  I  L  A  A  I  G  A  Y  P  L  S  R  K  H  G  T  E         p.160

          .         .         .         .         .         .       g.16031
 ACGCCGGCGGCCTGGGGGGACGGCTACCGCGCAGCCAAGGAGGAGCGCAAGGGGCCCACC       c.540
 T  P  A  A  W  G  D  G  Y  R  A  A  K  E  E  R  K  G  P  T         p.180

          .         .         .         .         .         .       g.16091
 CAGGCTGGGGCGGCGGCGGCGGCCACCGAACCCCCCGGGAAGCCGTCGGCCAAGGCGGAG       c.600
 Q  A  G  A  A  A  A  A  T  E  P  P  G  K  P  S  A  K  A  E         p.200

          .         .         .         .         .                 g.16145
 AAGGAGGCGGCGCGGAAGGCGGCCGGGAGCGCGGCGCCCCCGCCCGCGCAGTGA             c.654
 K  E  A  A  R  K  A  A  G  S  A  A  P  P  P  A  Q  X               p.217

          .         .         | 06         .         .         .    g.16437
 cgtctccagccccgcagcccggcccggg | cgtcctccgccagctcctgtgaccagcgcgtc    c.*60

          .         .         .         .         .         .       g.16497
 tcccgatgctctccgccgtgttcgtgtccccaggcgccctcgctgcagccccgcccccgt       c.*120

          .         .         .         .         .                 g.16548
 gggtctctgactctgtcgcttttctctaagtaaagatttcacgtccaccgg                c.*171

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Calcyon neuron-specific vesicular protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.