caveolin 1, caveolae protein, 22kDa (CAV1) - coding DNA reference sequence

(used for variant description)

(last modified June 28, 2024)

This file was created to facilitate the description of sequence variants on transcript NM_001753.4 in the CAV1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering CAV1 transcript NM_001753.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5038
                       gggagaaacgttctcactcgctctctgctcgctgcggg       c.-241

 .         .         .         .         .         .                g.5098
 cgctccccgccctctgctgccagaaccttggggatgtgcctagacccggcgcagcacacg       c.-181

 .         .         .         .         .         .                g.5158
 tccgggccaaccgcgagcagaacaaacctttggcgggcggccaggaggctccctcccagc       c.-121

 .         .         .         .         .         .                g.5218
 caccgcccccctccagcgcctttttttccccccatacaatacaagatcttccttcctcag       c.-61

 .         .         .         .         .         .                g.5278
 ttcccttaaagcacagcccagggaaacctcctcacagttttcatccagccacgggccagc       c.-1

          .         .         . | 02       .         .         .    g.6770
 ATGTCTGGGGGCAAATACGTAGACTCGGAG | GGACATCTCTACACCGTTCCCATCCGGGAA    c.60
 M  S  G  G  K  Y  V  D  S  E   | G  H  L  Y  T  V  P  I  R  E      p.20

          .         .         .         .         .         .       g.6830
 CAGGGCAACATCTACAAGCCCAACAACAAGGCCATGGCAGACGAGCTGAGCGAGAAGCAA       c.120
 Q  G  N  I  Y  K  P  N  N  K  A  M  A  D  E  L  S  E  K  Q         p.40

          .         .         .         .         .         .       g.6890
 GTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAAC       c.180
 V  Y  D  A  H  T  K  E  I  D  L  V  N  R  D  P  K  H  L  N         p.60

          .      | 03  .         .         .         .         .    g.39206
 GATGACGTGGTCAAG | ATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGT    c.240
 D  D  V  V  K   | I  D  F  E  D  V  I  A  E  P  E  G  T  H  S      p.80

          .         .         .         .         .         .       g.39266
 TTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTAC       c.300
 F  D  G  I  W  K  A  S  F  T  T  F  T  V  T  K  Y  W  F  Y         p.100

          .         .         .         .         .         .       g.39326
 CGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCC       c.360
 R  L  L  S  A  L  F  G  I  P  M  A  L  I  W  G  I  Y  F  A         p.120

          .         .         .         .         .         .       g.39386
 ATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAG       c.420
 I  L  S  F  L  H  I  W  A  V  V  P  C  I  K  S  F  L  I  E         p.140

          .         .         .         .         .         .       g.39446
 ATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTT       c.480
 I  Q  C  I  S  R  V  Y  S  I  Y  V  H  T  V  C  D  P  L  F         p.160

          .         .         .         .         .                 g.39503
 GAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAA          c.537
 E  A  V  G  K  I  F  S  N  V  R  I  N  L  Q  K  E  I  X            p.178

          .         .         .         .         .         .       g.39563
 atgacatttcaaggatagaagtatacctgattttttttccttttaattttcctggtgcca       c.*60

          .         .         .         .         .         .       g.39623
 atttcaagttccaagttgctaatacagcaacaatttatgaattgaattatcttggttgaa       c.*120

          .         .         .         .         .         .       g.39683
 aataaaaagatcactttctcagttttcataagtattatgtctcttctgagctatttcatc       c.*180

          .         .         .         .         .         .       g.39743
 tatttttggcagtctgaatttttaaaacccatttaaatttttttccttacctttttattt       c.*240

          .         .         .         .         .         .       g.39803
 gcatgtggatcaaccatcgctttattggctgagatatgaacatattgttgaaaggtaatt       c.*300

          .         .         .         .         .         .       g.39863
 tgagagaaatatgaagaactgaggaggaaaaaaaaaaaaaagaaaagaaccaacaacctc       c.*360

          .         .         .         .         .         .       g.39923
 aactgcctactccaaaatgttggtcattttatgttaagggaagaattccagggtatggcc       c.*420

          .         .         .         .         .         .       g.39983
 atggagtgtacaagtatgtgggcagattttcagcaaactcttttcccactgtttaaggag       c.*480

          .         .         .         .         .         .       g.40043
 ttagtggattactgccattcacttcataatccagtaggatccagtgatccttacaagtta       c.*540

          .         .         .         .         .         .       g.40103
 gaaaacataatcttctgccttctcatgatccaactaatgccttactcttcttgaaatttt       c.*600

          .         .         .         .         .         .       g.40163
 aacctatgatattttctgtgcctgaatatttgttatgtagataacaagacctcagtgcct       c.*660

          .         .         .         .         .         .       g.40223
 tcctgtttttcacattttccttttcaaatagggtctaactcagcaactcgctttaggtca       c.*720

          .         .         .         .         .         .       g.40283
 gcagcctccctgaagaccaaaattagaatatccatgacctagttttccatgcgtgtttct       c.*780

          .         .         .         .         .         .       g.40343
 gactctgagctacagagtctggtgaagctcacttctgggcttcatctggcaacatcttta       c.*840

          .         .         .         .         .         .       g.40403
 tccgtagtgggtatggttgacactagcccaatgaaatgaattaaagtggaccaatagggc       c.*900

          .         .         .         .         .         .       g.40463
 tgagctctctgtgggctggcagtcctggaagccagctttccctgcctctcatcaactgaa       c.*960

          .         .         .         .         .         .       g.40523
 tgaggtcagcatgtctattcagcttcgtttattttcaagaataatcacgctttcctgaat       c.*1020

          .         .         .         .         .         .       g.40583
 ccaaactaatccatcaccggggtggtttagtggctcaacattgtgttcccatttcagctg       c.*1080

          .         .         .         .         .         .       g.40643
 atcagtgggcctccaaggaggggctgtaaaatggaggccattgtgtgagcctatcagagt       c.*1140

          .         .         .         .         .         .       g.40703
 tgctgcaaacctgacccctgctcagtaaagcacttgcaaccgtctgttatgctgtgacac       c.*1200

          .         .         .         .         .         .       g.40763
 atggcccctccccctgccaggagctttggacctaatccaagcatccctttgcccagaaag       c.*1260

          .         .         .         .         .         .       g.40823
 aagatgggggaggaggcagtaataaaaagattgaagtattttgctggaataagttcaaat       c.*1320

          .         .         .         .         .         .       g.40883
 tcttctgaactcaaactgaggaatttcacctgtaaacctgagtcgtacagaaagctgcct       c.*1380

          .         .         .         .         .         .       g.40943
 ggtatatccaaaagctttttattcctcctgctcatattgtgattctgcctttggggactt       c.*1440

          .         .         .         .         .         .       g.41003
 ttcttaaaccttcagttatgatttttttttcatacacttattggaactctgcttgatttt       c.*1500

          .         .         .         .         .         .       g.41063
 tgcctcttccagtcttcctgacactttaattaccaacctgttacctactttgactttttg       c.*1560

          .         .         .         .         .         .       g.41123
 catttaaaacagacactggcatggatatagttttacttttaaactgtgtacataactgaa       c.*1620

          .         .         .         .         .         .       g.41183
 aatgtgctatactgcatactttttaaatgtaaagatatttttatctttatatgaagaaaa       c.*1680

          .         .         .         .         .         .       g.41243
 tcacttaggaaatggctttgtgattcaatctgtaaactgtgtattccaagacatgtctgt       c.*1740

          .         .         .         .         .         .       g.41303
 tctacatagatgcttagtccctcatgcaaatcaattactggtccaaaagattgctgaaat       c.*1800

          .         .         .         .         .         .       g.41363
 tttatatgcttactgatatattttacaattttttatcatgcatgtcctgtaaaggttaca       c.*1860

          .         .         .                                     g.41401
 agcctgcacaataaaaatgtttaacggttaaacagtca                             c.*1898

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Caveolin 1, caveolae protein, 22kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.