caveolin 3 (CAV3) - coding DNA reference sequence

(used for variant description)

(last modified January 20, 2019)

This file was created to facilitate the description of sequence variants in the CAV3 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008797.1, covering CAV3 transcript variant-1 (NM_033337.2). An alternatively spliced transcript has been reported, removing part of exon 2 (after the stop codon, NM_001234.3).

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5017
                                            ctctctgccccaagtat       c.-61

 .         .         .         .         .         .                g.5077
 tttcagccccagccggccacacagctcggatctcctcctgtggatccccccagctctgcg       c.-1

          .         .         .         .         .         .       g.5137
 ATGATGGCAGAAGAGCACACAGATCTCGAGGCCCAGATCGTCAAGGATATCCACTGCAAG       c.60
 M  M  A  E  E  H  T  D  L  E  A  Q  I  V  K  D  I  H  C  K         p.20

          .         .         .         .         .     | 02   .    g.16732
 GAGATTGACCTGGTGAACCGAGACCCCAAGAACATTAACGAGGACATAGTCAAG | GTGGAT    c.120
 E  I  D  L  V  N  R  D  P  K  N  I  N  E  D  I  V  K   | V  D      p.40

          .         .         .         .         .         .       g.16792
 TTTGAAGACGTGATCGCAGAGCCTGTGGGCACCTACAGCTTTGACGGCGTGTGGAAGGTG       c.180
 F  E  D  V  I  A  E  P  V  G  T  Y  S  F  D  G  V  W  K  V         p.60

          .         .         .         .         .         .       g.16852
 AGCTACACCACCTTCACTGTCTCCAAGTACTGGTGCTACCGTCTGTTGTCCACGCTGCTG       c.240
 S  Y  T  T  F  T  V  S  K  Y  W  C  Y  R  L  L  S  T  L  L         p.80

          .         .         .         .         .         .       g.16912
 GGCGTCCCACTGGCCCTGCTCTGGGGCTTCCTGTTCGCCTGCATCTCCTTCTGCCACATC       c.300
 G  V  P  L  A  L  L  W  G  F  L  F  A  C  I  S  F  C  H  I         p.100

          .         .         .         .         .         .       g.16972
 TGGGCGGTGGTGCCATGCATTAAGAGCTACCTGATCGAGATCCAGTGCATCAGCCACATC       c.360
 W  A  V  V  P  C  I  K  S  Y  L  I  E  I  Q  C  I  S  H  I         p.120

          .         .         .         .         .         .       g.17032
 TACTCACTCTGCATCCGCACCTTCTGCAACCCACTCTTCGCGGCCCTGGGCCAGGTCTGC       c.420
 Y  S  L  C  I  R  T  F  C  N  P  L  F  A  A  L  G  Q  V  C         p.140

          .         .         .                                     g.17068
 AGCAGCATCAAGGTGGTGCTGCGGAAGGAGGTCTAA                               c.456
 S  S  I  K  V  V  L  R  K  E  V  X                                 p.151

        | intron       .         .         .         .         .     g.17128
 agccag | gtggggcaacagcggtggcagggcagggggtggtgggccagactggtccccggg     c.*60
        ^  alternatively spliced

          .         .         .         .   | 02b    .         .     g.17188
 ggacttcttcacaggggctgctggcgagctctttctctttag | ggactgctccatacccca     c.*120
                                            |

          .         .         .         .         .         .       g.17248
 tgatggagcacacggtgtagggaagccagaaagaaaagacggcccagccacagaagcaca       c.*180

          .         .         .         .         .         .       g.17308
 atggcccttcgctctcccccagccccaccatgatgcccccatgcctgggcgtgggggaag       c.*240

          .         .         .         .         .         .       g.17368
 atcatttgccaagaggcagctactgcaagtctttgcgttcacttgtactgtaacaacata       c.*300

          .         .         .         .         .         .       g.17428
 aaccagcacgcggttcccacccggggccaacctctccacgcgcactcaggaaagtgacca       c.*360

          .         .         .         .         .         .       g.17488
 gtgaccactggcgttaggaaggtggctccagtaaagggttttggctgcatttggggaatg       c.*420

          .         .         .         .         .         .       g.17548
 ctgcattttgttcgtgcctgtaagattggtttgtgtcctgaccagctccaaaaatatact       c.*480

          .         .         .         .         .         .       g.17608
 tcactgccctgaaaaacagacacagggagagttggttgtctcttcacttggccaaatgta       c.*540

          .         .         .         .         .         .       g.17668
 agtgaagaacagagtctttttcttcttcggattctattgtttgctggaaccgtacacgtt       c.*600

          .         .         .         .         .         .       g.17728
 ccttggaagatcatgtttaagtgactcctgttgcctgagcacaaaaatgggcaccaatgg       c.*660

          .         .         .         .         .         .       g.17788
 aggaaaatgacccttgggctggcaggggcagtgacccttccagggtaccactgagggaag       c.*720

          .         .         .         .         .         .       g.17848
 ggcctgggttcaagcctcccggaacctcccctttggctaaccgagcccctgaaatgccca       c.*780

          .         .         .         .         .         .       g.17908
 gtactgccatttgacatgagggtaccttcgccctcaggagatgtgacgaaggaacaaggt       c.*840

          .         .         .         .         .                 g.17966
 ctaatttgtgcgtgtgtggactcactatggaaataaaatgcagtagaaagagcatgta         c.*898

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Caveolin 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.