chibby homolog 1 (Drosophila) (CBY1) - coding DNA reference sequence

(used for variant description)

(last modified June 26, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_001002880.1 in the CBY1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_047138.1, covering CBY1 transcript NM_001002880.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5027
                                  aggcggcaggaggcgggtgggtcaagg       c.-121

 .         .         .         .         .         .                g.5087
 taactctgggctacagagtccttgctgggggttcggggagcgcttggaccccggcttctg       c.-61

 .         . | 02       .         .         .         .             g.13942
 ggacgcgtcag | aatattatccagcaatgcaaatgaacaaactataactacacacagctgc    c.-1

          .         .         .         .         .         .       g.14002
 ATGGATAAATGTCAGAAACATGACGTTGAGTGTGAGAAGCCAGATGCAAACGAGGACTCA       c.60
 M  D  K  C  Q  K  H  D  V  E  C  E  K  P  D  A  N  E  D  S         p.20

          .         .         .  | 03      .         .         .    g.16393
 CTGTGCAATTCTGTGCATGTACAGTGGCCAG | GAGAAGGGAGCACTGGCTTTGCTTTCATC    c.120
 L  C  N  S  V  H  V  Q  W  P  G |   E  G  S  T  G  F  A  F  I      p.40

          .         .         .         .         .         .       g.16453
 AGGCCAAAGATGCCTTTCTTTGGGAATACGTTCAGTCCGAAGAAGACACCTCCTCGGAAG       c.180
 R  P  K  M  P  F  F  G  N  T  F  S  P  K  K  T  P  P  R  K         p.60

          .         .        | 04.         .         .         .    g.19264
 TCGGCATCTCTCTCCAACCTGCATTCT | TTGGATCGATCAACCCGGGAGGTGGAGCTGGGC    c.240
 S  A  S  L  S  N  L  H  S   | L  D  R  S  T  R  E  V  E  L  G      p.80

          .         .         .         .         .         .       g.19324
 TTGGAATACGGATCCCCGACTATGAACCTGGCAGGGCAAAGCCTGAAGTTTGAAAATGGC       c.300
 L  E  Y  G  S  P  T  M  N  L  A  G  Q  S  L  K  F  E  N  G         p.100

          .    | 05    .         .         .         .         .    g.19464
 CAGTGGATAGCAG | AGACAGGGGTTAGTGGCGGTGTGGACCGGAGGGAGGTTCAGCGCCTT    c.360
 Q  W  I  A  E |   T  G  V  S  G  G  V  D  R  R  E  V  Q  R  L      p.120

          .         .         .         .         .         .       g.19524
 CGCAGGCGGAACCAGCAGTTGGAGGAAGAGAACAATCTCTTGCGGCTGAAAGTGGACATC       c.420
 R  R  R  N  Q  Q  L  E  E  E  N  N  L  L  R  L  K  V  D  I         p.140

          .   | 06     .         .         .         .         .    g.21554
 TTATTAGACATG | CTTTCAGAGTCCACTGCTGAATCCCACTTAATGGAGAAGGAACTGGAT    c.480
 L  L  D  M   | L  S  E  S  T  A  E  S  H  L  M  E  K  E  L  D      p.160

          .         .         .                                     g.21584
 GAACTGAGGATCAGCCGGAAGAGAAAATGA                                     c.510
 E  L  R  I  S  R  K  R  K  X                                       p.169

          .         .         .         .         .         .       g.21644
 agaccccagagacatttattggggagtaggatgtggctgagtgctttttttttggccaga       c.*60

          .         .         .         .         .         .       g.21704
 ctagcggattcagtcctggaagagagtatcatataatgagacccacaggcactggcaccc       c.*120

          .         .         .         .         .         .       g.21764
 ttgggttggcaatagaaggtgacatggaatggagaaaaccaagattccagatggggatag       c.*180

          .         .         .         .         .         .       g.21824
 taactagaaggtgcttcagatgcactgcctgcgggtgccagtctgaaaaccagaccgcac       c.*240

          .         .         .         .         .         .       g.21884
 agaggcctggggctgctgatgagctttttggtgctctccacacacaagctcgcaaacaca       c.*300

          .         .         .         .         .         .       g.21944
 catgtcccagaatagctctgttgggttgtgttgggagaagcggctggagttcattctctc       c.*360

          .         .         .         .         .         .       g.22004
 acccccttatgttggtgtttggcgtgtgacagcagttctacagagctctgtgttggggtc       c.*420

          .         .         .         .         .         .       g.22064
 atggatgagcggctctcttggctcttaaaggcaggcctctctcttcttgcctttaaagaa       c.*480

          .         .         .         .         .         .       g.22124
 tcctccttcctcacacctggcctcctctggcttcagcttctcagcagcaagcaccagcct       c.*540

          .         .         .         .         .         .       g.22184
 tccacaacaacactatatttttatgctactttcctgtttgcactactacttttttattaa       c.*600

          .                                                         g.22198
 acgatgttaaataa                                                     c.*614

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Chibby homolog 1 (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.