coiled-coil domain containing 23 (CCDC23) - coding DNA reference sequence

(used for variant description)

(last modified June 12, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_199342.3 in the CCDC23 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering CCDC23 transcript NM_199342.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5055
      cgcggccgctcctgcgggcggaagcctcctggcgctcggccctgcgcccctcccc       c.-181

 .         .         .         .         .         .                g.5115
 ccggcgcgcggccccgcccaggacgaggggcggtgggcaggcagcgctgggtccagtggt       c.-121

 .         .         .         .         .         .                g.5175
 cgggggaaggcgaggattaccctcccggaggcgttgtctgcgactcggcggaggctccaa       c.-61

 .         .         .    | 02    .         .         .             g.5844
 cttccagtggcccggtcgggaaag | atcagagcctcctaagaaatatccagaagtcaagcc    c.-1

          .         .         .         .         .         .       g.5904
 ATGGATCCACCTGCACGTAAAGAAAAAACCAAAGTTAAAGAATCTGTCAGCAGAGTTGAG       c.60
 M  D  P  P  A  R  K  E  K  T  K  V  K  E  S  V  S  R  V  E         p.20

          .         .         .         .         .     | 03   .    g.14894
 AAGGCCAAACAGAAATCAGCCCAGCAGGAGCTGAAGCAGAGACAAAGAGCAGAG | ATCTAT    c.120
 K  A  K  Q  K  S  A  Q  Q  E  L  K  Q  R  Q  R  A  E   | I  Y      p.40

          .         .         .         .         .         .       g.14954
 GCCCTCAACAGAGTCATGACAGAACTGGAGCAGCAGCAGTTTGATGAGTTCTGTAAACAG       c.180
 A  L  N  R  V  M  T  E  L  E  Q  Q  Q  F  D  E  F  C  K  Q         p.60

          .         .                                               g.14975
 ATGCAGCCTCCTGGAGAATGA                                              c.201
 M  Q  P  P  G  E  X                                                p.66

          .         .         .         .         .         .       g.15035
 ggccccaggttcaaaccagatgggatcctgagagctttgagagggtgttgccagttttaa       c.*60

          .         .         .         .         .         .       g.15095
 gctgagatggcccatttggagccttacagaactagaccagaagacatttgtggataaatc       c.*120

          .         .         .         .         .         .       g.15155
 tgaactcacttcctgtgtgtaacttctaacttcactggttcctcccatctgaattggcca       c.*180

          .         .         .         .         .         .       g.15215
 catgcttgctgaagagacttgttttcttcttctaagacagtggttttgttttttgggttt       c.*240

          .         .         .         .         .         .       g.15275
 ttttaaaaaaaaaaaaaaaacacacacaaaaaacactttttctattgtttgagaaaaatc       c.*300

          .         .         .         .         .         .       g.15335
 agtgtttctcatgaaactctatatcttctccaaaaatacaaataaaatactaataaaatg       c.*360

                                                                    g.15337
 tt                                                                 c.*362

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Coiled-coil domain containing 23 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.